Rmu_sc0000927.1_g000007

Heavy metal-associated isoprenylated plant protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000927.1
Physical Location & Seq
Reverse (-)
60996 .. 61727
732 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000927.1_g000007.1.cds

Sequence Viewer

Length: 438 bp
atgggtgctcttaattatctttccaacttttgcactgtcactaggacaaggaccaagaggaaaacaatgcagaaagttgagatcaaagtcaaaatggattgtgatggctgtgaaagaaaagttaagaaggctgtttcgactatgaaaggtgtagaaagtgtggaggtgaaccgaaaacaaagtcgggtaattgtaaacgggtatgtggaagcaaacagggttttgaagagagttaagagcacgggcaaaagagctgaaatttggccatacatccctcaacatcttgtccattatccacacgcctccggagcctacgacaaaagggcaccaccaggtcacgttaagaatacatttgcttttccggcctctgatgcatctgacaacaacattgtctcatttttcagtgatgacaatgtaaatgcttgttctataatgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

145

Amino Acids

16.31

Weight (kDa)

9.78

Isoelectric Point (pI)

40.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 325
AccIII TCCGGA 1 cut(s) 305
AcoI YGGCCR 1 cut(s) 263
AcsI RAATTY 1 cut(s) 258
AgsI TTSAA 1 cut(s) 226
AjnI CCWGG 1 cut(s) 331
AluBI AGCT 1 cut(s) 254
AluI AGCT 1 cut(s) 254
Alw21I GWGCWC 2 cut(s) 10, 242
Alw26I GTCTC 1 cut(s) 397
Aor13HI TCCGGA 1 cut(s) 305
AoxI GGCC 2 cut(s) 263, 363
ApoI RAATTY 1 cut(s) 258
ArsI GACNNNNNNTTYG 2 cut(s) 166, 198
AspS9I GGNCC 1 cut(s) 51
AsuHPI GGTGA 1 cut(s) 178
AvaII GGWCC 1 cut(s) 51
BaeGI GKGCMC 1 cut(s) 328
BalI TGGCCA 1 cut(s) 265
BanI GGYRCC 1 cut(s) 325
Bbv12I GWGCWC 2 cut(s) 10, 242
BccI CCATC 1 cut(s) 98
BciT130I CCWGG 1 cut(s) 333
BcoDI GTCTC 1 cut(s) 397
BfaI CTAG 1 cut(s) 42
Bme1390I CCNGG 1 cut(s) 333
Bme18I GGWCC 1 cut(s) 51
BmgT120I GGNCC 1 cut(s) 51
BmiI GGNNCC 2 cut(s) 310, 327
BmrFI CCNGG 1 cut(s) 333
BmsI GCATC 2 cut(s) 361, 383
BsaWI WCCGGW 1 cut(s) 305
BseAI TCCGGA 1 cut(s) 305
BseBI CCWGG 1 cut(s) 333
BseGI GGATG 1 cut(s) 270
BseSI GKGCMC 1 cut(s) 328
BshFI GGCC 2 cut(s) 265, 365
BshNI GGYRCC 1 cut(s) 325
BsiHKAI GWGCWC 2 cut(s) 10, 242
BsiSI CCGG 2 cut(s) 306, 362
BsmAI GTCTC 1 cut(s) 397
BsnI GGCC 2 cut(s) 265, 365
Bsp1286I GDGCHC 3 cut(s) 10, 242, 328
Bsp13I TCCGGA 1 cut(s) 305
Bsp143I GATC 1 cut(s) 81
BspANI GGCC 2 cut(s) 265, 365
BspEI TCCGGA 1 cut(s) 305
BspLI GGNNCC 2 cut(s) 310, 327
BspT107I GGYRCC 1 cut(s) 325
BssMI GATC 1 cut(s) 81
Bst2UI CCWGG 1 cut(s) 333
Bst4CI ACNGT 1 cut(s) 37
Bst6I CTCTTC 1 cut(s) 221
BstF5I GGATG 1 cut(s) 270
BstKTI GATC 1 cut(s) 84
BstMAI GTCTC 1 cut(s) 397
BstMBI GATC 1 cut(s) 81
BstMWI GCNNNNNNNGC 3 cut(s) 308, 362, 371
BstNI CCWGG 1 cut(s) 333
BstSCI CCNGG 1 cut(s) 331
BstSLI GKGCMC 1 cut(s) 328
BsuRI GGCC 2 cut(s) 265, 365
BtsCI GGATG 1 cut(s) 270
BtsIMutI CAGTG 2 cut(s) 33, 409
Cfr13I GGNCC 1 cut(s) 51
CsiI ACCWGGT 1 cut(s) 331
CviJI RGCY 6 cut(s) 108, 131, 254, 265, 311, 365
CviKI_1 RGCY 6 cut(s) 108, 131, 254, 265, 311, 365
DpnI GATC 1 cut(s) 83
DpnII GATC 1 cut(s) 81
EaeI YGGCCR 1 cut(s) 263
Eam1104I CTCTTC 1 cut(s) 221
EarI CTCTTC 1 cut(s) 221
Eco47I GGWCC 1 cut(s) 51
EcoRII CCWGG 1 cut(s) 331
EcoT22I ATGCAT 1 cut(s) 376
FaiI YATR 4 cut(s) 143, 204, 268, 431
FokI GGATG 1 cut(s) 257
FspBI CTAG 1 cut(s) 42
HaeIII GGCC 2 cut(s) 265, 365
HapII CCGG 2 cut(s) 306, 362
HpaII CCGG 2 cut(s) 306, 362
HphI GGTGA 1 cut(s) 178
Hpy166II GTNNAC 2 cut(s) 169, 196
Hpy188I TCNGA 2 cut(s) 370, 379
Hpy188III TCNNGA 1 cut(s) 306
Hpy8I GTNNAC 2 cut(s) 169, 196
HpyAV CCTTC 1 cut(s) 121
HpyCH4III ACNGT 1 cut(s) 37
HpyCH4IV ACGT 1 cut(s) 339
HpyCH4V TGCA 3 cut(s) 33, 70, 374
HpyF10VI GCNNNNNNNGC 3 cut(s) 308, 362, 371
HpySE526I ACGT 1 cut(s) 339
Kpn2I TCCGGA 1 cut(s) 305
Kzo9I GATC 1 cut(s) 81
LmnI GCTCC 1 cut(s) 308
LpnPI CCDG 5 cut(s) 202, 318, 319, 345, 375
LweI GCATC 2 cut(s) 361, 383
MabI ACCWGGT 1 cut(s) 331
MaeI CTAG 1 cut(s) 42
MaeII ACGT 1 cut(s) 339
MaeIII GTNAC 2 cut(s) 37, 335
MalI GATC 1 cut(s) 83
MboI GATC 1 cut(s) 81
MboII GAAGA 1 cut(s) 238
MhlI GDGCHC 3 cut(s) 10, 242, 328
MlsI TGGCCA 1 cut(s) 265
MluCI AATT 3 cut(s) 13, 189, 258
MluNI TGGCCA 1 cut(s) 265
MmeI TCCRAC 1 cut(s) 48
MnlI CCTC 5 cut(s) 51, 157, 285, 313, 376
Mox20I TGGCCA 1 cut(s) 265
Mph1103I ATGCAT 1 cut(s) 376
MroI TCCGGA 1 cut(s) 305
MscI TGGCCA 1 cut(s) 265
MseI TTAA 4 cut(s) 12, 123, 234, 342
Msp20I TGGCCA 1 cut(s) 265
MspI CCGG 2 cut(s) 306, 362
MspR9I CCNGG 1 cut(s) 333
MvaI CCWGG 1 cut(s) 333
MwoI GCNNNNNNNGC 3 cut(s) 308, 362, 371
NdeII GATC 1 cut(s) 81
NlaIV GGNNCC 2 cut(s) 310, 327
NmuCI GTSAC 2 cut(s) 37, 335
NsiI ATGCAT 1 cut(s) 376
Psp6I CCWGG 1 cut(s) 331
PspGI CCWGG 1 cut(s) 331
PspN4I GGNNCC 2 cut(s) 310, 327
PspPI GGNCC 1 cut(s) 51
SaqAI TTAA 4 cut(s) 12, 123, 234, 342
Sau3AI GATC 1 cut(s) 81
Sau96I GGNCC 1 cut(s) 51
ScrFI CCNGG 1 cut(s) 333
SduI GDGCHC 3 cut(s) 10, 242, 328
SetI ASST 5 cut(s) 151, 168, 256, 337, 342
SexAI ACCWGGT 1 cut(s) 331
SfaNI GCATC 2 cut(s) 361, 383
SinI GGWCC 1 cut(s) 51
Sse9I AATT 3 cut(s) 13, 189, 258
SspMI CTAG 1 cut(s) 42
StyD4I CCNGG 1 cut(s) 331
TaaI ACNGT 1 cut(s) 37
TaiI ACGT 1 cut(s) 342
TaqI TCGA 1 cut(s) 137
TasI AATT 3 cut(s) 13, 189, 258
Tru1I TTAA 4 cut(s) 12, 123, 234, 342
Tru9I TTAA 4 cut(s) 12, 123, 234, 342
TscAI CASTG 2 cut(s) 40, 409
TseFI GTSAC 2 cut(s) 37, 335
Tsp45I GTSAC 2 cut(s) 37, 335
TspDTI ATGAA 1 cut(s) 158
TspRI CASTG 2 cut(s) 40, 409
VpaK11BI GGWCC 1 cut(s) 51
XapI RAATTY 1 cut(s) 258
XspI CTAG 1 cut(s) 42
Zsp2I ATGCAT 1 cut(s) 376
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.