Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001051.1

Orthogroup ID

OG0015449

Physical Location & Seq

Genomic Coordinates Forward (+)

209633 .. 211135

Gene Structure 1503 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001051.1_g000060.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1095 bp

atgaagaaaggctctggagcttccctggatttggggacacttccaggtcaaaagggttggaactcagaacgagtgaggacactgagtaataacaatggtggaggtggagggaggactttgggttcgaaatgggaagatgcagaaaggtggatttgcagcccaaatctcggacttggcaaagacagaagcaaggatatggattctcatggccagaagaggaggcccaagtccaagagtggtccgattgtgccgccgggagctttgtactactcgaataattcacctacaaatccaggttttgaaggtggaagtttagggaactttgttactggttccccattctcaactggagttttggcagctgatagcgtctgtcttaactatggagggatgggaagatcaacaagcctgcttggaatgccagaattcctgaatgagaagtttgatgataacagtagtgaggagccaatggttgctcgtgctgtttcacaaagagatatgggaacccaaataagccaaaatgcagagggttgtctacagtcatcatcaccaaggagaaggtcatcatttgctccatcttctcccactctggtttctattgtggagcagcaacgtgaacattttgcaagatttgaggtcagagaagtgcaggtagacaatcgagtcaccgttgttaatgggtctagaggaagttgcgccgaaaacaccaagaaaagtccaccggatgtcaatgacttcggcaacattgcttttcaggacataactccatcttttaacattgcagaagcagcaatgaatatatcaaggttgcaaagagaggaagccaagatcagtgcatgggagaacttgcagaaagcaagagctgaagcggcactacgaaaactagagatgaaattggaaaagaagaaatcgtcaacaatggataagattatgaagaagctgagcaaagcacaagttaaagccaataagatgagaagctcaatggcagtaggagacagccatcaacttgccgaaactccaagcaaggctcgttcgtttagtaagagtgtccgaataggtttgctgcggaggtgctttacctgcaatgccctttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Remorin_C

Protein Analysis

364

Amino Acids

39.58

Weight (kDa)

9.75

Isoelectric Point (pI)

56.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015449)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G36970
fragaria_vesca	FvH4_1g16090 FvH4_1g16090
malus_domestica	MD02G1172500.v1.1
prunus_persica	Prupe.7G133000_v2.0.a1
pyrus_communis	pycom02g13900
rosa_chinensis	RchiOBHm_Chr2g0105711
rosa_laevigata	RLG00000017452
rosa_multiflora	Rmu_sc0001051.1_g000060
rosa_roxburghii	Rroxscaffold_2G00137960
rosa_rugosa	Rorug02G0129700
rosa_samantha	Rh2AG181100 Rh2BG190200 Rh2CG185300 Rh2DG187100
rosa_wichuraiana	Rw2G014160

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	662
Acc36I	ACCTGC	2 cut(s)	640, 1088
AccI	GTMKAC	2 cut(s)	535, 654
AciI	CCGC	3 cut(s)	251, 869, 1066
AcoI	YGGCCR	1 cut(s)	208
AcsI	RAATTY	1 cut(s)	425
AcuI	CTGAAG	1 cut(s)	885
AfaI	GTAC	1 cut(s)	266
AfiI	CCNNNNNNNGG	2 cut(s)	31, 167
AgsI	TTSAA	1 cut(s)	302
AjnI	CCWGG	3 cut(s)	24, 43, 292
AloI	GAACNNNNNNTCC	2 cut(s)	106, 138
AluBI	AGCT	6 cut(s)	20, 260, 362, 863, 940, 978
AluI	AGCT	6 cut(s)	20, 260, 362, 863, 940, 978
Alw26I	GTCTC	1 cut(s)	987
AoxI	GGCC	2 cut(s)	208, 221
ApeKI	GCWGC	5 cut(s)	156, 359, 607, 788, 1063
ApoI	RAATTY	1 cut(s)	425
ArsI	GACNNNNNNTTYG	2 cut(s)	106, 138
AspLEI	GCGC	1 cut(s)	698
AspS9I	GGNCC	2 cut(s)	222, 239
AsuC2I	CCSGG	1 cut(s)	255
AsuHPI	GGTGA	3 cut(s)	273, 540, 658
AsuII	TTCGAA	1 cut(s)	125
AvaII	GGWCC	1 cut(s)	239
BalI	TGGCCA	1 cut(s)	210
BarI	GAAGNNNNNNTAC	2 cut(s)	858, 890
BauI	CACGAG	1 cut(s)	477
BbvI	GCAGC	5 cut(s)	168, 371, 619, 800, 1050
BccI	CCATC	4 cut(s)	385, 583, 775, 1008
BciT130I	CCWGG	3 cut(s)	26, 45, 294
BcnI	CCSGG	1 cut(s)	255
BcoDI	GTCTC	1 cut(s)	987
BfaI	CTAG	2 cut(s)	684, 884
BfmI	CTRYAG	1 cut(s)	536
BfuAI	ACCTGC	2 cut(s)	640, 1088
BisI	GCNGC	7 cut(s)	157, 251, 360, 608, 789, 870, 1064
BlpI	GCTNAGC	1 cut(s)	941
BlsI	GCNGC	7 cut(s)	158, 252, 361, 609, 790, 871, 1065
Bme1390I	CCNGG	4 cut(s)	26, 45, 255, 294
Bme18I	GGWCC	1 cut(s)	239
BmgT120I	GGNCC	2 cut(s)	222, 239
BmiI	GGNNCC	3 cut(s)	334, 465, 505
BmrFI	CCNGG	4 cut(s)	26, 45, 255, 294
BmsI	GCATC	1 cut(s)	127
BpmI	CTGGAG	2 cut(s)	36, 369
Bpu1102I	GCTNAGC	1 cut(s)	941
Bpu14I	TTCGAA	1 cut(s)	125
BpuMI	CCSGG	1 cut(s)	255
BsaJI	CCNNGG	2 cut(s)	24, 551
BsaWI	WCCGGW	1 cut(s)	721
Bsc4I	CCNNNNNNNGG	2 cut(s)	31, 167
Bse1I	ACTGG	2 cut(s)	334, 352
Bse3DI	GCAATG	4 cut(s)	744, 777, 798, 1090
BseBI	CCWGG	3 cut(s)	26, 45, 294
BseDI	CCNNGG	2 cut(s)	24, 551
BseGI	GGATG	2 cut(s)	396, 730
BseLI	CCNNNNNNNGG	2 cut(s)	31, 167
BseMI	GCAATG	4 cut(s)	744, 777, 798, 1090
BseMII	CTCAG	3 cut(s)	74, 78, 932
BseNI	ACTGG	2 cut(s)	334, 352
BseRI	GAGGAG	2 cut(s)	232, 476
BseXI	GCAGC	5 cut(s)	168, 371, 619, 800, 1050
BsgI	GTGCAG	1 cut(s)	668
BshFI	GGCC	2 cut(s)	210, 223
BsiSI	CCGG	2 cut(s)	254, 722
BslFI	GGGAC	1 cut(s)	49
BslI	CCNNNNNNNGG	2 cut(s)	31, 167
BsmAI	GTCTC	1 cut(s)	987
BsmFI	GGGAC	1 cut(s)	49
BsmI	GAATGC	1 cut(s)	423
BsnI	GGCC	2 cut(s)	210, 223
Bsp119I	TTCGAA	1 cut(s)	125
Bsp143I	GATC	2 cut(s)	398, 828
Bsp1720I	GCTNAGC	1 cut(s)	941
BspACI	CCGC	3 cut(s)	251, 869, 1066
BspANI	GGCC	2 cut(s)	210, 223
BspCNI	CTCAG	3 cut(s)	75, 77, 933
BspLI	GGNNCC	3 cut(s)	334, 465, 505
BspMI	ACCTGC	2 cut(s)	640, 1088
BspT104I	TTCGAA	1 cut(s)	125
BsrDI	GCAATG	4 cut(s)	744, 777, 798, 1090
BsrI	ACTGG	2 cut(s)	334, 352
BssECI	CCNNGG	2 cut(s)	24, 551
BssMI	GATC	2 cut(s)	398, 828
BssSI	CACGAG	1 cut(s)	477
BssT1I	CCWWGG	1 cut(s)	551
Bst2BI	CACGAG	1 cut(s)	477
Bst2UI	CCWGG	3 cut(s)	26, 45, 294
Bst4CI	ACNGT	3 cut(s)	455, 540, 670
Bst6I	CTCTTC	1 cut(s)	209
BstBI	TTCGAA	1 cut(s)	125
BstC8I	GCNNGC	1 cut(s)	410
BstDEI	CTNAG	3 cut(s)	64, 83, 941
BstF5I	GGATG	2 cut(s)	396, 730
BstHHI	GCGC	1 cut(s)	698
BstKTI	GATC	2 cut(s)	401, 831
BstMAI	GTCTC	1 cut(s)	987
BstMBI	GATC	2 cut(s)	398, 828
BstMWI	GCNNNNNNNGC	4 cut(s)	418, 788, 869, 1080
BstNI	CCWGG	3 cut(s)	26, 45, 294
BstSCI	CCNGG	4 cut(s)	24, 43, 253, 292
BstSFI	CTRYAG	1 cut(s)	536
BstV1I	GCAGC	5 cut(s)	168, 371, 619, 800, 1050
BsuRI	GGCC	2 cut(s)	210, 223
BtsCI	GGATG	2 cut(s)	396, 730
BtsIMutI	CAGTG	2 cut(s)	80, 838
BveI	ACCTGC	2 cut(s)	640, 1088
Cac8I	GCNNGC	1 cut(s)	410
CfoI	GCGC	1 cut(s)	698
Cfr13I	GGNCC	2 cut(s)	222, 239
CseI	GACGC	1 cut(s)	358
Csp6I	GTAC	1 cut(s)	265
CviAII	CATG	2 cut(s)	206, 837
CviQI	GTAC	1 cut(s)	265
DdeI	CTNAG	3 cut(s)	64, 83, 941
DpnI	GATC	2 cut(s)	400, 830
DpnII	GATC	2 cut(s)	398, 828
DrdI	GACNNNNNNGTC	1 cut(s)	662
DseDI	GACNNNNNNGTC	1 cut(s)	662
EaeI	YGGCCR	1 cut(s)	208
Eam1104I	CTCTTC	1 cut(s)	209
EarI	CTCTTC	1 cut(s)	209
Eco130I	CCWWGG	1 cut(s)	551
Eco47I	GGWCC	1 cut(s)	239
Eco57I	CTGAAG	1 cut(s)	885
EcoRI	GAATTC	1 cut(s)	425
EcoRII	CCWGG	3 cut(s)	24, 43, 292
EcoT14I	CCWWGG	1 cut(s)	551
ErhI	CCWWGG	1 cut(s)	551
FaeI	CATG	2 cut(s)	209, 840
FaiI	YATR	8 cut(s)	197, 207, 384, 500, 761, 800, 838, 932
FaqI	GGGAC	1 cut(s)	49
FatI	CATG	2 cut(s)	205, 836
FblI	GTMKAC	2 cut(s)	535, 654
Fnu4HI	GCNGC	7 cut(s)	157, 251, 360, 608, 789, 870, 1064
FokI	GGATG	2 cut(s)	403, 737
Fsp4HI	GCNGC	7 cut(s)	157, 251, 360, 608, 789, 870, 1064
FspBI	CTAG	2 cut(s)	684, 884
GlaI	GCGC	1 cut(s)	697
GluI	GCNGC	7 cut(s)	157, 251, 360, 608, 789, 870, 1064
GsuI	CTGGAG	2 cut(s)	36, 369
HaeIII	GGCC	2 cut(s)	210, 223
HapII	CCGG	2 cut(s)	254, 722
HgaI	GACGC	1 cut(s)	358
HhaI	GCGC	1 cut(s)	698
Hin1II	CATG	2 cut(s)	209, 840
Hin6I	GCGC	1 cut(s)	696
HinP1I	GCGC	1 cut(s)	696
HincII	GTYRAC	1 cut(s)	915
HindII	GTYRAC	1 cut(s)	915
HinfI	GANTC	2 cut(s)	200, 663
HpaII	CCGG	2 cut(s)	254, 722
HphI	GGTGA	3 cut(s)	273, 540, 658
Hpy166II	GTNNAC	5 cut(s)	536, 617, 655, 719, 915
Hpy188I	TCNGA	5 cut(s)	67, 170, 243, 641, 1052
Hpy188III	TCNNGA	4 cut(s)	15, 430, 684, 755
Hpy8I	GTNNAC	5 cut(s)	536, 617, 655, 719, 915
HpyAV	CCTTC	2 cut(s)	296, 552
HpyCH4III	ACNGT	3 cut(s)	455, 540, 670
HpyCH4IV	ACGT	1 cut(s)	613
HpyF10VI	GCNNNNNNNGC	4 cut(s)	418, 788, 869, 1080
HpyF3I	CTNAG	3 cut(s)	64, 83, 941
HpySE526I	ACGT	1 cut(s)	613
Hsp92II	CATG	2 cut(s)	209, 840
HspAI	GCGC	1 cut(s)	696
Kzo9I	GATC	2 cut(s)	398, 828
LmnI	GCTCC	5 cut(s)	17, 257, 463, 577, 604
Lsp1109I	GCAGC	5 cut(s)	168, 371, 619, 800, 1050
LweI	GCATC	1 cut(s)	127
MaeI	CTAG	2 cut(s)	684, 884
MaeII	ACGT	1 cut(s)	613
MaeIII	GTNAC	2 cut(s)	325, 664
MalI	GATC	2 cut(s)	400, 830
MboI	GATC	2 cut(s)	398, 828
MboII	GAAGA	7 cut(s)	16, 146, 226, 408, 570, 916, 946
MlsI	TGGCCA	1 cut(s)	210
MluCI	AATT	3 cut(s)	277, 425, 893
MluNI	TGGCCA	1 cut(s)	210
MlyI	GAGTC	1 cut(s)	672
MmeI	TCCRAC	1 cut(s)	38
Mox20I	TGGCCA	1 cut(s)	210
MscI	TGGCCA	1 cut(s)	210
MseI	TTAA	5 cut(s)	378, 675, 774, 957, 1093
Msp20I	TGGCCA	1 cut(s)	210
MspA1I	CMGCKG	1 cut(s)	362
MspI	CCGG	2 cut(s)	254, 722
MspR9I	CCNGG	4 cut(s)	26, 45, 255, 294
Mva1269I	GAATGC	1 cut(s)	423
MvaI	CCWGG	3 cut(s)	26, 45, 294
MwoI	GCNNNNNNNGC	4 cut(s)	418, 788, 869, 1080
NciI	CCSGG	1 cut(s)	255
NdeII	GATC	2 cut(s)	398, 828
NlaIII	CATG	2 cut(s)	209, 840
NlaIV	GGNNCC	3 cut(s)	334, 465, 505
NmuCI	GTSAC	1 cut(s)	664
NspV	TTCGAA	1 cut(s)	125
PctI	GAATGC	1 cut(s)	423
PfeI	GAWTC	1 cut(s)	200
PkrI	GCNGC	7 cut(s)	158, 252, 361, 609, 790, 871, 1065
PleI	GAGTC	1 cut(s)	671
PpsI	GAGTC	1 cut(s)	671
Psp6I	CCWGG	3 cut(s)	24, 43, 292
PspGI	CCWGG	3 cut(s)	24, 43, 292
PspN4I	GGNNCC	3 cut(s)	334, 465, 505
PspPI	GGNCC	2 cut(s)	222, 239
PvuII	CAGCTG	1 cut(s)	362
RsaI	GTAC	1 cut(s)	266
RsaNI	GTAC	1 cut(s)	265
SaqAI	TTAA	5 cut(s)	378, 675, 774, 957, 1093
SatI	GCNGC	7 cut(s)	157, 251, 360, 608, 789, 870, 1064
Sau3AI	GATC	2 cut(s)	398, 828
Sau96I	GGNCC	2 cut(s)	222, 239
SchI	GAGTC	1 cut(s)	672
ScrFI	CCNGG	4 cut(s)	26, 45, 255, 294
SfaNI	GCATC	1 cut(s)	127
SfcI	CTRYAG	1 cut(s)	536
SfuI	TTCGAA	1 cut(s)	125
SinI	GGWCC	1 cut(s)	239
Sse9I	AATT	3 cut(s)	277, 425, 893
SsiI	CCGC	3 cut(s)	251, 869, 1066
SspMI	CTAG	2 cut(s)	684, 884
StyD4I	CCNGG	4 cut(s)	24, 43, 253, 292
StyI	CCWWGG	1 cut(s)	551
TaaI	ACNGT	3 cut(s)	455, 540, 670
TaiI	ACGT	1 cut(s)	616
TaqI	TCGA	3 cut(s)	125, 272, 661
TasI	AATT	3 cut(s)	277, 425, 893
TatI	WGTACW	1 cut(s)	264
TauI	GCSGC	2 cut(s)	253, 872
TfiI	GAWTC	1 cut(s)	200
Tru1I	TTAA	5 cut(s)	378, 675, 774, 957, 1093
Tru9I	TTAA	5 cut(s)	378, 675, 774, 957, 1093
TscAI	CASTG	2 cut(s)	87, 838
TseFI	GTSAC	1 cut(s)	664
TseI	GCWGC	5 cut(s)	156, 359, 607, 788, 1063
Tsp45I	GTSAC	1 cut(s)	664
TspDTI	ATGAA	4 cut(s)	17, 809, 905, 947
TspRI	CASTG	2 cut(s)	87, 838
VpaK11BI	GGWCC	1 cut(s)	239
XapI	RAATTY	1 cut(s)	425
XbaI	TCTAGA	1 cut(s)	683
XmiI	GTMKAC	2 cut(s)	535, 654
XspI	CTAG	2 cut(s)	684, 884

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.