Rmu_sc0001176.1_g000013

Probable zinc-ribbon domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001176.1
Physical Location & Seq
Reverse (-)
52846 .. 53061
216 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001176.1_g000013.1.cds

Sequence Viewer

Length: 216 bp
atgcctgggaactatgttggtggaaatactggtatttttgtaagtggaagagatcttcatgaaagggatttggatttgttggccagtcgaggacttcccactgccatagatagatcttacatcattgagatctcaaggagagtccttgatgaggacactggtgaagaacttgatagccttggcatgcttgccccaactgttcagaaggtgaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

7.77

Weight (kDa)

4.72

Isoelectric Point (pI)

46.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 81
AfiI CCNNNNNNNGG 1 cut(s) 151
AjnI CCWGG 1 cut(s) 4
AoxI GGCC 1 cut(s) 81
AsuHPI GGTGA 1 cut(s) 173
BalI TGGCCA 1 cut(s) 83
BciT130I CCWGG 1 cut(s) 6
BglII AGATCT 3 cut(s) 52, 113, 129
Bme1390I CCNGG 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 6
BpuEI CTTGAG 1 cut(s) 118
BsaJI CCNNGG 2 cut(s) 5, 178
Bsc4I CCNNNNNNNGG 1 cut(s) 151
Bse1I ACTGG 3 cut(s) 34, 84, 163
BseBI CCWGG 1 cut(s) 6
BseDI CCNNGG 2 cut(s) 5, 178
BseLI CCNNNNNNNGG 1 cut(s) 151
BseNI ACTGG 3 cut(s) 34, 84, 163
BshFI GGCC 1 cut(s) 83
BslI CCNNNNNNNGG 1 cut(s) 151
BsnI GGCC 1 cut(s) 83
Bsp143I GATC 3 cut(s) 52, 113, 129
BspANI GGCC 1 cut(s) 83
BspHI TCATGA 1 cut(s) 58
BsrI ACTGG 3 cut(s) 34, 84, 163
BssECI CCNNGG 2 cut(s) 5, 178
BssMI GATC 3 cut(s) 52, 113, 129
BssT1I CCWWGG 1 cut(s) 178
Bst2UI CCWGG 1 cut(s) 6
Bst4CI ACNGT 1 cut(s) 199
Bst6I CTCTTC 1 cut(s) 43
BstC8I GCNNGC 2 cut(s) 185, 189
BstENI CCTNNNNNAGG 1 cut(s) 149
BstKTI GATC 3 cut(s) 55, 116, 132
BstMBI GATC 3 cut(s) 52, 113, 129
BstNI CCWGG 1 cut(s) 6
BstNSI RCATGY 1 cut(s) 187
BstSCI CCNGG 1 cut(s) 4
BstX2I RGATCY 3 cut(s) 52, 113, 129
BstYI RGATCY 3 cut(s) 52, 113, 129
BsuRI GGCC 1 cut(s) 83
BtsI GCAGTG 1 cut(s) 99
BtsIMutI CAGTG 2 cut(s) 99, 156
Cac8I GCNNGC 2 cut(s) 185, 189
CciI TCATGA 1 cut(s) 58
CviAII CATG 2 cut(s) 59, 184
CviJI RGCY 2 cut(s) 83, 177
CviKI_1 RGCY 2 cut(s) 83, 177
DpnI GATC 3 cut(s) 54, 115, 131
DpnII GATC 3 cut(s) 52, 113, 129
EaeI YGGCCR 1 cut(s) 81
Eam1104I CTCTTC 1 cut(s) 43
EarI CTCTTC 1 cut(s) 43
Eco130I CCWWGG 1 cut(s) 178
EcoNI CCTNNNNNAGG 1 cut(s) 149
EcoRII CCWGG 1 cut(s) 4
EcoT14I CCWWGG 1 cut(s) 178
ErhI CCWWGG 1 cut(s) 178
FaeI CATG 2 cut(s) 62, 187
FaiI YATR 4 cut(s) 15, 60, 107, 185
FatI CATG 2 cut(s) 58, 183
HaeIII GGCC 1 cut(s) 83
Hin1II CATG 2 cut(s) 62, 187
HinfI GANTC 1 cut(s) 141
HphI GGTGA 1 cut(s) 173
Hpy188I TCNGA 1 cut(s) 204
Hpy188III TCNNGA 1 cut(s) 59
HpyAV CCTTC 1 cut(s) 199
HpyCH4III ACNGT 1 cut(s) 199
Hsp92II CATG 2 cut(s) 62, 187
Kzo9I GATC 3 cut(s) 52, 113, 129
LpnPI CCDG 4 cut(s) 15, 18, 97, 144
MalI GATC 3 cut(s) 54, 115, 131
MboI GATC 3 cut(s) 52, 113, 129
MboII GAAGA 3 cut(s) 47, 60, 176
MflI RGATCY 3 cut(s) 52, 113, 129
MlsI TGGCCA 1 cut(s) 83
MluNI TGGCCA 1 cut(s) 83
MlyI GAGTC 1 cut(s) 150
MnlI CCTC 2 cut(s) 83, 145
Mox20I TGGCCA 1 cut(s) 83
MscI TGGCCA 1 cut(s) 83
Msp20I TGGCCA 1 cut(s) 83
MspR9I CCNGG 1 cut(s) 6
MvaI CCWGG 1 cut(s) 6
NdeII GATC 3 cut(s) 52, 113, 129
NlaIII CATG 2 cut(s) 62, 187
NspI RCATGY 1 cut(s) 187
PaeI GCATGC 1 cut(s) 187
PagI TCATGA 1 cut(s) 58
PleI GAGTC 1 cut(s) 149
PpsI GAGTC 1 cut(s) 149
Psp6I CCWGG 1 cut(s) 4
PspGI CCWGG 1 cut(s) 4
PsuI RGATCY 3 cut(s) 52, 113, 129
Sau3AI GATC 3 cut(s) 52, 113, 129
SchI GAGTC 1 cut(s) 150
ScrFI CCNGG 1 cut(s) 6
SetI ASST 1 cut(s) 210
SmlI CTYRAG 1 cut(s) 133
SmoI CTYRAG 1 cut(s) 133
SphI GCATGC 1 cut(s) 187
StyD4I CCNGG 1 cut(s) 4
StyI CCWWGG 1 cut(s) 178
TaaI ACNGT 1 cut(s) 199
TaqI TCGA 1 cut(s) 88
TscAI CASTG 2 cut(s) 106, 163
TspDTI ATGAA 2 cut(s) 47, 75
TspRI CASTG 2 cut(s) 106, 163
XagI CCTNNNNNAGG 1 cut(s) 149
XceI RCATGY 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.