Rmu_sc0001287.1_g000041

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001287.1
OG0013061
Physical Location & Seq
Forward (+)
213087 .. 214641
1555 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001287.1_g000041.1.cds

Sequence Viewer

Length: 432 bp
atgaggtttatgttttgcaagattcattgtcctccctttatttgcttttgtaagccttcccctcatatatacactcctggaccactcaagctagagaataccccacctccaaatccaaatccagatccaaatccacatgttccttcttcaaaacctgaggcctctgatcagttacctaatgaccccattgagatcaaggaagagagcttagctgagaatccaaaaccagctgagaattctctgaaaagtaatctcagaaagccggattcttcagaccctgctgctccaaaagacgagatgaagaagagagtgcagtggatggactttttagggaaggaccttgttgagatcagggaatttgaaagcagtgaattagatgacactgacagcgaatacgagaacagaagaggctgcatttgtgttattctatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

143

Amino Acids

16.25

Weight (kDa)

4.99

Isoelectric Point (pI)

52.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013061)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G13480 AT3G13480
fragaria_vesca FvH4_3g45780
malus_domestica MD03G1003200.v1.1 MD11G1003000.v1.1
prunus_persica Prupe.6G002800_v2.0.a1 Prupe.6G002800_v2.0.a1
pyrus_communis pycom03g00320
rosa_chinensis RchiOBHm_Chr5g0083851
rosa_laevigata RLG00000037058
rosa_multiflora Rmu_sc0001287.1_g000041
rosa_roxburghii Rroxscaffold_1G00000740
rosa_rugosa Rorug05G0486600
rosa_samantha Rh5AG539700 Rh5BG564800 Rh5CG586700 Rh5DG573300
rosa_wichuraiana Rw5G050180

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 119
AcsI RAATTY 2 cut(s) 235, 356
AcuI CTGAAG 1 cut(s) 255
AflIII ACRYGT 1 cut(s) 136
AgsI TTSAA 2 cut(s) 150, 362
AjnI CCWGG 1 cut(s) 76
AluBI AGCT 4 cut(s) 91, 207, 212, 230
AluI AGCT 4 cut(s) 91, 207, 212, 230
AlwI GGATC 1 cut(s) 119
AlwNI CAGNNNCTG 1 cut(s) 278
AoxI GGCC 1 cut(s) 159
ApeKI GCWGC 2 cut(s) 281, 411
ApoI RAATTY 2 cut(s) 235, 356
AspS9I GGNCC 2 cut(s) 80, 337
AvaII GGWCC 2 cut(s) 80, 337
AxyI CCTNAGG 1 cut(s) 156
BbvI GCAGC 2 cut(s) 268, 398
BccI CCATC 1 cut(s) 313
BciT130I CCWGG 1 cut(s) 78
BclI TGATCA 1 cut(s) 166
BfaI CTAG 1 cut(s) 92
BisI GCNGC 2 cut(s) 282, 412
BlpI GCTNAGC 1 cut(s) 208
BlsI GCNGC 2 cut(s) 283, 413
Bme1390I CCNGG 1 cut(s) 78
Bme18I GGWCC 2 cut(s) 80, 337
BmgT120I GGNCC 2 cut(s) 80, 337
BmrFI CCNGG 1 cut(s) 78
Bpu1102I GCTNAGC 1 cut(s) 208
BpuEI CTTGAG 1 cut(s) 71
BsaBI GATNNNNATC 1 cut(s) 129
BsaXI ACNNNNNCTCC 2 cut(s) 91, 121
Bse21I CCTNAGG 1 cut(s) 156
Bse8I GATNNNNATC 1 cut(s) 129
BseBI CCWGG 1 cut(s) 78
BseGI GGATG 1 cut(s) 324
BseJI GATNNNNATC 1 cut(s) 129
BseMII CTCAG 4 cut(s) 147, 204, 222, 268
BseXI GCAGC 2 cut(s) 268, 398
BsgI GTGCAG 1 cut(s) 332
BshFI GGCC 1 cut(s) 161
BsiSI CCGG 1 cut(s) 263
BsnI GGCC 1 cut(s) 161
Bsp143I GATC 4 cut(s) 124, 166, 192, 348
Bsp1720I GCTNAGC 1 cut(s) 208
BspANI GGCC 1 cut(s) 161
BspCNI CTCAG 4 cut(s) 148, 205, 223, 267
BspPI GGATC 1 cut(s) 119
BssMI GATC 4 cut(s) 124, 166, 192, 348
Bst2UI CCWGG 1 cut(s) 78
Bst6I CTCTTC 3 cut(s) 195, 299, 400
BstDEI CTNAG 5 cut(s) 156, 208, 213, 231, 254
BstF5I GGATG 1 cut(s) 324
BstKTI GATC 4 cut(s) 127, 169, 195, 351
BstMBI GATC 4 cut(s) 124, 166, 192, 348
BstNI CCWGG 1 cut(s) 78
BstNSI RCATGY 1 cut(s) 140
BstSCI CCNGG 1 cut(s) 76
BstV1I GCAGC 2 cut(s) 268, 398
BstX2I RGATCY 1 cut(s) 124
BstYI RGATCY 1 cut(s) 124
Bsu36I CCTNAGG 1 cut(s) 156
BsuRI GGCC 1 cut(s) 161
BtsCI GGATG 1 cut(s) 324
BtsI GCAGTG 2 cut(s) 320, 373
BtsIMutI CAGTG 3 cut(s) 320, 373, 381
CaiI CAGNNNCTG 1 cut(s) 278
Cfr13I GGNCC 2 cut(s) 80, 337
CviAII CATG 1 cut(s) 137
CviJI RGCY 8 cut(s) 55, 91, 161, 207, 212, 230, 262, 411
CviKI_1 RGCY 8 cut(s) 55, 91, 161, 207, 212, 230, 262, 411
DdeI CTNAG 5 cut(s) 156, 208, 213, 231, 254
DpnI GATC 4 cut(s) 126, 168, 194, 350
DpnII GATC 4 cut(s) 124, 166, 192, 348
Eam1104I CTCTTC 3 cut(s) 195, 299, 400
EarI CTCTTC 3 cut(s) 195, 299, 400
Eco147I AGGCCT 1 cut(s) 161
Eco47I GGWCC 2 cut(s) 80, 337
Eco57I CTGAAG 1 cut(s) 255
Eco81I CCTNAGG 1 cut(s) 156
EcoO109I RGGNCCY 1 cut(s) 337
EcoRI GAATTC 1 cut(s) 235
EcoRII CCWGG 1 cut(s) 76
FaeI CATG 1 cut(s) 140
FaiI YATR 6 cut(s) 11, 66, 68, 70, 138, 430
FatI CATG 1 cut(s) 136
FbaI TGATCA 1 cut(s) 166
Fnu4HI GCNGC 2 cut(s) 282, 412
FokI GGATG 1 cut(s) 331
Fsp4HI GCNGC 2 cut(s) 282, 412
FspBI CTAG 1 cut(s) 92
GluI GCNGC 2 cut(s) 282, 412
HaeIII GGCC 1 cut(s) 161
HapII CCGG 1 cut(s) 263
Hin1II CATG 1 cut(s) 140
HinfI GANTC 3 cut(s) 22, 217, 266
HpaII CCGG 1 cut(s) 263
Hpy188I TCNGA 4 cut(s) 166, 243, 257, 274
Hpy188III TCNNGA 1 cut(s) 122
HpyAV CCTTC 3 cut(s) 66, 153, 328
HpyCH4V TGCA 3 cut(s) 18, 313, 414
HpyF3I CTNAG 5 cut(s) 156, 208, 213, 231, 254
Hsp92II CATG 1 cut(s) 140
Ksp22I TGATCA 1 cut(s) 166
Kzo9I GATC 4 cut(s) 124, 166, 192, 348
LmnI GCTCC 1 cut(s) 289
LpnPI CCDG 8 cut(s) 63, 90, 135, 168, 240, 276, 291, 337
Lsp1109I GCAGC 2 cut(s) 268, 398
MaeI CTAG 1 cut(s) 92
MaeIII GTNAC 1 cut(s) 171
MalI GATC 4 cut(s) 126, 168, 194, 350
MboI GATC 4 cut(s) 124, 166, 192, 348
MboII GAAGA 6 cut(s) 138, 212, 261, 313, 316, 417
MflI RGATCY 1 cut(s) 124
MluCI AATT 3 cut(s) 235, 356, 371
MnlI CCTC 6 cut(s) 42, 72, 117, 151, 172, 401
MspA1I CMGCKG 1 cut(s) 230
MspI CCGG 1 cut(s) 263
MspR9I CCNGG 1 cut(s) 78
MvaI CCWGG 1 cut(s) 78
NdeII GATC 4 cut(s) 124, 166, 192, 348
NlaIII CATG 1 cut(s) 140
NspI RCATGY 1 cut(s) 140
PceI AGGCCT 1 cut(s) 161
PciI ACATGT 1 cut(s) 136
PfeI GAWTC 3 cut(s) 22, 217, 266
PfoI TCCNGGA 1 cut(s) 76
PkrI GCNGC 2 cut(s) 283, 413
PpuMI RGGWCCY 1 cut(s) 337
PscI ACATGT 1 cut(s) 136
Psp5II RGGWCCY 1 cut(s) 337
Psp6I CCWGG 1 cut(s) 76
PspGI CCWGG 1 cut(s) 76
PspPI GGNCC 2 cut(s) 80, 337
PspPPI RGGWCCY 1 cut(s) 337
PstNI CAGNNNCTG 1 cut(s) 278
PsuI RGATCY 1 cut(s) 124
PvuII CAGCTG 1 cut(s) 230
SatI GCNGC 2 cut(s) 282, 412
Sau3AI GATC 4 cut(s) 124, 166, 192, 348
Sau96I GGNCC 2 cut(s) 80, 337
ScrFI CCNGG 1 cut(s) 78
SetI ASST 9 cut(s) 8, 93, 109, 157, 178, 209, 214, 232, 342
SinI GGWCC 2 cut(s) 80, 337
SmlI CTYRAG 1 cut(s) 86
SmoI CTYRAG 1 cut(s) 86
Sse9I AATT 3 cut(s) 235, 356, 371
SseBI AGGCCT 1 cut(s) 161
SspMI CTAG 1 cut(s) 92
StuI AGGCCT 1 cut(s) 161
StyD4I CCNGG 1 cut(s) 76
TasI AATT 3 cut(s) 235, 356, 371
TfiI GAWTC 3 cut(s) 22, 217, 266
TscAI CASTG 3 cut(s) 320, 373, 388
TseI GCWGC 2 cut(s) 281, 411
TspDTI ATGAA 2 cut(s) 14, 314
TspRI CASTG 3 cut(s) 320, 373, 388
VpaK11BI GGWCC 2 cut(s) 80, 337
XapI RAATTY 2 cut(s) 235, 356
XceI RCATGY 1 cut(s) 140
XspI CTAG 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.