Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001324.1

Orthogroup ID

OG0008452

Physical Location & Seq

Genomic Coordinates Forward (+)

25607 .. 28844

Gene Structure 3238 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001324.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1830 bp

atggaaagaagtgaacccacattagttccagaatggctgagaagtacaggcagtgttactgggggtggcagttcaacccaccattttgcatcatcttcagatgttccgtccttggctcatcacatgagaaatagaccttcaaagagcatagctgaatttgatagccctcgttctccttatttggaccgctcttcctcctctaattcccggaggagttctagcaatggttctgcaaagcatgcctacagtagttttaacagaagccaccgtgacaaggaccgcgaaaaggaaaaagaaagattaaattttggcgaaccttgggaccgtgactgttctgaccctttgggaagcttgtataccagtaaggaccatttgcgacgttcccagcctatgctttccaggaataagagtgaagtgttgccccgaagagctgctattgattcaaaaagttgtagcaacagcagtcataacaatggcaatggtctgatttctggggttggagttggtgttcagaatactgtgtttgataaggattttccctcacttggaactgaagaaaggcaaggtgtgcctgatattggcagagtcccatctccgggatttacctcagctgttcagagcctgcctgttggcaattcagctttaattgggggagagcagtttaaatcagctttggcagaggtgcctaatgctataattggaagcagtagctcaggatcattttcggttcaaccaactgctgttgctgctacttcagtgtcaggggcttccattgcaacggctggtcttaacatggccgaagcattagcgcaagctccagcaagagctcgcactgctcctcagttatctatcaagacacaaaggcttgaggaattggctctcaagcagccgaggcaattaataccggtgacaccttcaatgccaaaatcttcagctcttaattcttctgacaagttaaagcccaaaacagcagtcagagctggtgagatgaatgcacctgttaagggtgggcagcagcagccctctcagtcgcaccatgccaatcaatctcttcatggggggcctgtcaagtctgatgctccaaagacatctcatgggaagttccttgttctcaaaccagtatgggaaaatggtatctcttcttctccaaaggatgtcactagccccacaagtaatgcaagcagcagagcagcaaatagcccacttgctgttgctcctccagttgtgtccgcttcttcaaggagccctaacaatccaaagctttcggcggtggaaagaaaggtagctgccttggatctgaaatctggagccactttggaaaagagaccttctttgtctcaagtccagagccggaatgatttctttaatcttctaaagaagaaaacctcagtgaacagttcaaatactcttccagattcaggccctaatatttcatctcccactatggagaaatctggtgacataactagggaagtattcagtgatcctgcgagccctcacattgaaaatggtggtgaggtgactggcaacggtgatagctcggaagaggttcagagattttctggtactggcccaagtgcagcagtttatccggatgaggaagaggctcgtttccttcgttctcttggatgggaggaaaattctggtgatgacggcggtctaacggaagaagagatcaatgccttttatgaccagtatatgaaatcaagaccatctctcaaactgagtcgaggcatgccgaagctttcaatgctgcctgaatctcatgcaactaatttggatggggcaactactgaactgagctcatctgactctgggtctgaagcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

609

Amino Acids

64.58

Weight (kDa)

8.79

Isoelectric Point (pI)

63.41

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008452)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G36990 AT4G08510 AT4G08510
fragaria_vesca	FvH4_5g38960 FvH4_5g38960 FvH4_5g38960 FvH4_5g38960
malus_domestica	MD08G1173100.v1.1 MD15G1358400.v1.1
prunus_persica	Prupe.1G505900_v2.0.a1
pyrus_communis	pycom15g32070 pycom15g32080
rosa_chinensis	RchiOBHm_Chr7g0240931
rosa_laevigata	RLG00000000613
rosa_multiflora	Rmu_sc0001324.1_g000003 Rmu_sc0031641.1_g000001
rosa_roxburghii	Rroxscaffold_3G00219410
rosa_rugosa	Rorug07G0340300
rosa_samantha	Rh7AG494800 Rh7BG466400 Rh7CG512900 Rh7DG479700
rosa_wichuraiana	Rw7G041850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	682
AccBSI	CCGCTC	1 cut(s)	189
AccI	GTMKAC	1 cut(s)	356
AccII	CGCG	1 cut(s)	282
AccIII	TCCGGA	1 cut(s)	1591
AciI	CCGC	5 cut(s)	187, 280, 1230, 1268, 1656
AclWI	GGATC	3 cut(s)	724, 1302, 1478
AcoI	YGGCCR	1 cut(s)	795
AcsI	RAATTY	3 cut(s)	155, 304, 1639
AcuI	CTGAAG	4 cut(s)	81, 573, 738, 915
AfaI	GTAC	2 cut(s)	46, 1567
AfiI	CCNNNNNNNGG	8 cut(s)	274, 286, 545, 578, 595, 596, 1004, 1418
AgeI	ACCGGT	1 cut(s)	904
AgsI	TTSAA	9 cut(s)	75, 141, 444, 731, 918, 1239, 1401, 1505, 1749
AhdI	GACNNNNNGTC	1 cut(s)	1816
AjnI	CCWGG	1 cut(s)	398
AloI	GAACNNNNNNTCC	2 cut(s)	492, 524
Alw21I	GWGCWC	2 cut(s)	829, 1805
Alw26I	GTCTC	2 cut(s)	1318, 1341
AlwI	GGATC	3 cut(s)	724, 1302, 1478
AlwNI	CAGNNNCTG	1 cut(s)	622
Aor13HI	TCCGGA	1 cut(s)	1591
AoxI	GGCC	4 cut(s)	795, 1061, 1420, 1570
ApoI	RAATTY	3 cut(s)	155, 304, 1639
ArsI	GACNNNNNNTTYG	2 cut(s)	957, 989
AseI	ATTAAT	1 cut(s)	899
AsiGI	ACCGGT	1 cut(s)	904
Asp700I	GAANNNNTTC	2 cut(s)	1358, 1548
AspLEI	GCGC	1 cut(s)	811
AspS9I	GGNCC	7 cut(s)	184, 277, 322, 367, 1061, 1421, 1571
AsuC2I	CCSGG	2 cut(s)	208, 597
AsuHPI	GGTGA	7 cut(s)	919, 995, 1469, 1526, 1531, 1544, 1658
AvaII	GGWCC	4 cut(s)	184, 277, 322, 367
BanI	GGYRCC	1 cut(s)	682
BanII	GRGCYC	4 cut(s)	829, 1247, 1496, 1805
BarI	GAAGNNNNNNTAC	4 cut(s)	340, 372, 1126, 1158
Bbv12I	GWGCWC	2 cut(s)	829, 1805
BbvCI	CCTCAGC	1 cut(s)	607
BccI	CCATC	4 cut(s)	598, 1623, 1720, 1775
BceAI	ACGGC	2 cut(s)	795, 1669
BciT130I	CCWGG	1 cut(s)	400
BcnI	CCSGG	2 cut(s)	208, 597
BcoDI	GTCTC	2 cut(s)	1318, 1341
BfaI	CTAG	3 cut(s)	219, 1161, 1467
BfmI	CTRYAG	1 cut(s)	244
Bme1390I	CCNGG	3 cut(s)	208, 400, 597
Bme18I	GGWCC	4 cut(s)	184, 277, 322, 367
BmeRI	GACNNNNNGTC	1 cut(s)	1816
BmgT120I	GGNCC	7 cut(s)	184, 277, 322, 367, 1061, 1421, 1571
BmiI	GGNNCC	5 cut(s)	323, 684, 1062, 1244, 1309
BmrFI	CCNGG	3 cut(s)	208, 400, 597
BmrI	ACTGGG	1 cut(s)	69
BmsI	GCATC	2 cut(s)	98, 1066
BmuI	ACTGGG	1 cut(s)	69
BoxI	GACNNNNGTC	1 cut(s)	1656
BpmI	CTGGAG	3 cut(s)	801, 1203, 1326
Bpu10I	CCTNAGC	2 cut(s)	607, 712
BpuEI	CTTGAG	3 cut(s)	866, 887, 1323
BpuMI	CCSGG	2 cut(s)	208, 597
BsaI	GGTCTC	1 cut(s)	1318
BsaJI	CCNNGG	4 cut(s)	111, 317, 890, 1290
BsaWI	WCCGGW	2 cut(s)	904, 1591
BsaXI	ACNNNNNCTCC	2 cut(s)	492, 522
Bsc4I	CCNNNNNNNGG	8 cut(s)	274, 286, 545, 578, 595, 596, 1004, 1418
Bse118I	RCCGGY	1 cut(s)	904
Bse1I	ACTGG	7 cut(s)	64, 360, 1118, 1220, 1528, 1573, 1693
Bse3DI	GCAATG	3 cut(s)	229, 484, 771
BseAI	TCCGGA	1 cut(s)	1591
BseBI	CCWGG	1 cut(s)	400
BseDI	CCNNGG	4 cut(s)	111, 317, 890, 1290
BseGI	GGATG	4 cut(s)	1159, 1600, 1634, 1786
BseLI	CCNNNNNNNGG	8 cut(s)	274, 286, 545, 578, 595, 596, 1004, 1418
BseMI	GCAATG	3 cut(s)	229, 484, 771
BseMII	CTCAG	8 cut(s)	29, 621, 726, 854, 1040, 1401, 1715, 1790
BseNI	ACTGG	7 cut(s)	64, 360, 1118, 1220, 1528, 1573, 1693
BseRI	GAGGAG	4 cut(s)	187, 226, 828, 1206
BseYI	CCCAGC	1 cut(s)	384
BsgI	GTGCAG	1 cut(s)	1599
Bsh1236I	CGCG	1 cut(s)	282
BshFI	GGCC	4 cut(s)	797, 1063, 1422, 1572
BshNI	GGYRCC	1 cut(s)	682
BshTI	ACCGGT	1 cut(s)	904
BsiHKAI	GWGCWC	2 cut(s)	829, 1805
BsiSI	CCGG	5 cut(s)	208, 596, 905, 1351, 1592
BslFI	GGGAC	2 cut(s)	335, 572
BslI	CCNNNNNNNGG	8 cut(s)	274, 286, 545, 578, 595, 596, 1004, 1418
BsmAI	GTCTC	2 cut(s)	1318, 1341
BsmFI	GGGAC	2 cut(s)	335, 572
BsmI	GAATGC	1 cut(s)	997
BsnI	GGCC	4 cut(s)	797, 1063, 1422, 1572
Bso31I	GGTCTC	1 cut(s)	1318
Bsp1286I	GDGCHC	4 cut(s)	829, 1247, 1496, 1805
Bsp13I	TCCGGA	1 cut(s)	1591
Bsp143I	GATC	4 cut(s)	716, 1294, 1483, 1674
BspACI	CCGC	5 cut(s)	187, 280, 1230, 1268, 1656
BspANI	GGCC	4 cut(s)	797, 1063, 1422, 1572
BspCNI	CTCAG	8 cut(s)	30, 620, 725, 853, 1039, 1400, 1716, 1791
BspEI	TCCGGA	1 cut(s)	1591
BspFNI	CGCG	1 cut(s)	282
BspLI	GGNNCC	5 cut(s)	323, 684, 1062, 1244, 1309
BspPI	GGATC	3 cut(s)	724, 1302, 1478
BspQI	GCTCTTC	2 cut(s)	196, 421
BspT107I	GGYRCC	1 cut(s)	682
BspTNI	GGTCTC	1 cut(s)	1318
BsrBI	CCGCTC	1 cut(s)	189
BsrDI	GCAATG	3 cut(s)	229, 484, 771
BsrFI	RCCGGY	1 cut(s)	904
BsrI	ACTGG	7 cut(s)	64, 360, 1118, 1220, 1528, 1573, 1693
BssAI	RCCGGY	1 cut(s)	904
BssECI	CCNNGG	4 cut(s)	111, 317, 890, 1290
BssMI	GATC	4 cut(s)	716, 1294, 1483, 1674
BssNAI	GTATAC	1 cut(s)	357
BssT1I	CCWWGG	3 cut(s)	111, 317, 1290
Bst1107I	GTATAC	1 cut(s)	357
Bst2UI	CCWGG	1 cut(s)	400
Bst4CI	ACNGT	7 cut(s)	248, 269, 326, 332, 520, 1397, 1532
Bst6I	CTCTTC	8 cut(s)	196, 421, 1056, 1144, 1413, 1539, 1596, 1665
BstAPI	GCANNNNNTGC	2 cut(s)	239, 568
BstC8I	GCNNGC	7 cut(s)	240, 623, 813, 829, 1180, 1492, 1736
BstDEI	CTNAG	8 cut(s)	38, 607, 712, 840, 1026, 1387, 1724, 1799
BstF5I	GGATG	4 cut(s)	1159, 1600, 1634, 1786
BstFNI	CGCG	1 cut(s)	282
BstHHI	GCGC	1 cut(s)	811
BstKTI	GATC	4 cut(s)	719, 1297, 1486, 1677
BstMAI	GTCTC	2 cut(s)	1318, 1341
BstMBI	GATC	4 cut(s)	716, 1294, 1483, 1674
BstMWI	GCNNNNNNNGC	9 cut(s)	239, 568, 746, 773, 833, 892, 977, 1018, 1750
BstNI	CCWGG	1 cut(s)	400
BstNSI	RCATGY	2 cut(s)	242, 1738
BstPAI	GACNNNNGTC	1 cut(s)	1656
BstSCI	CCNGG	3 cut(s)	206, 398, 595
BstSFI	CTRYAG	1 cut(s)	244
BstUI	CGCG	1 cut(s)	282
BstX2I	RGATCY	1 cut(s)	1294
BstYI	RGATCY	1 cut(s)	1294
BstZ17I	GTATAC	1 cut(s)	357
BsuRI	GGCC	4 cut(s)	797, 1063, 1422, 1572
BtsCI	GGATG	4 cut(s)	1159, 1600, 1634, 1786
BtsI	GCAGTG	2 cut(s)	58, 831
BtsIMutI	CAGTG	5 cut(s)	58, 762, 831, 1395, 1486
Cac8I	GCNNGC	7 cut(s)	240, 623, 813, 829, 1180, 1492, 1736
CaiI	CAGNNNCTG	1 cut(s)	622
CfoI	GCGC	1 cut(s)	811
Cfr10I	RCCGGY	1 cut(s)	904
Cfr13I	GGNCC	7 cut(s)	184, 277, 322, 367, 1061, 1421, 1571
Csp6I	GTAC	2 cut(s)	45, 1566
CspAI	ACCGGT	1 cut(s)	904
CviAII	CATG	8 cut(s)	124, 239, 793, 1037, 1055, 1094, 1735, 1766
CviQI	GTAC	2 cut(s)	45, 1566
DdeI	CTNAG	8 cut(s)	38, 607, 712, 840, 1026, 1387, 1724, 1799
DpnI	GATC	4 cut(s)	718, 1296, 1485, 1676
DpnII	GATC	4 cut(s)	716, 1294, 1483, 1674
DraI	TTTAAA	1 cut(s)	664
DriI	GACNNNNNGTC	1 cut(s)	1816
EaeI	YGGCCR	1 cut(s)	795
Eam1104I	CTCTTC	8 cut(s)	196, 421, 1056, 1144, 1413, 1539, 1596, 1665
Eam1105I	GACNNNNNGTC	1 cut(s)	1816
EarI	CTCTTC	8 cut(s)	196, 421, 1056, 1144, 1413, 1539, 1596, 1665
Ecl136II	GAGCTC	2 cut(s)	827, 1803
Eco130I	CCWWGG	3 cut(s)	111, 317, 1290
Eco24I	GRGCYC	4 cut(s)	829, 1247, 1496, 1805
Eco31I	GGTCTC	1 cut(s)	1318
Eco47I	GGWCC	4 cut(s)	184, 277, 322, 367
Eco53kI	GAGCTC	2 cut(s)	827, 1803
Eco57I	CTGAAG	4 cut(s)	81, 573, 738, 915
EcoICRI	GAGCTC	2 cut(s)	827, 1803
EcoO109I	RGGNCCY	2 cut(s)	1061, 1421
EcoRII	CCWGG	1 cut(s)	398
EcoT14I	CCWWGG	3 cut(s)	111, 317, 1290
EcoT38I	GRGCYC	4 cut(s)	829, 1247, 1496, 1805
ErhI	CCWWGG	3 cut(s)	111, 317, 1290
FaeI	CATG	8 cut(s)	127, 242, 796, 1040, 1058, 1097, 1738, 1769
FaqI	GGGAC	2 cut(s)	335, 572
FatI	CATG	8 cut(s)	123, 238, 792, 1036, 1054, 1093, 1734, 1765
FblI	GTMKAC	1 cut(s)	356
FokI	GGATG	4 cut(s)	1166, 1607, 1641, 1793
FriOI	GRGCYC	4 cut(s)	829, 1247, 1496, 1805
FspBI	CTAG	3 cut(s)	219, 1161, 1467
GlaI	GCGC	1 cut(s)	810
GsaI	CCCAGC	1 cut(s)	388
GsuI	CTGGAG	3 cut(s)	801, 1203, 1326
HaeIII	GGCC	4 cut(s)	797, 1063, 1422, 1572
HapII	CCGG	5 cut(s)	208, 596, 905, 1351, 1592
HhaI	GCGC	1 cut(s)	811
Hin1II	CATG	8 cut(s)	127, 242, 796, 1040, 1058, 1097, 1738, 1769
Hin6I	GCGC	1 cut(s)	809
HinP1I	GCGC	1 cut(s)	809
HindIII	AAGCTT	4 cut(s)	349, 1259, 1742, 1824
HinfI	GANTC	6 cut(s)	440, 585, 1415, 1726, 1760, 1811
HpaII	CCGG	5 cut(s)	208, 596, 905, 1351, 1592
HphI	GGTGA	7 cut(s)	919, 995, 1469, 1526, 1531, 1544, 1658
Hpy166II	GTNNAC	3 cut(s)	14, 357, 1393
Hpy188III	TCNNGA	8 cut(s)	29, 714, 853, 1305, 1345, 1412, 1592, 1707
Hpy8I	GTNNAC	3 cut(s)	14, 357, 1393
Hpy99I	CGWCG	1 cut(s)	381
HpyAV	CCTTC	4 cut(s)	147, 924, 1338, 1625
HpyCH4III	ACNGT	7 cut(s)	248, 269, 326, 332, 520, 1397, 1532
HpyCH4IV	ACGT	1 cut(s)	379
HpyCH4V	TGCA	7 cut(s)	89, 233, 776, 995, 1178, 1580, 1769
HpyF10VI	GCNNNNNNNGC	9 cut(s)	239, 568, 746, 773, 833, 892, 977, 1018, 1750
HpyF3I	CTNAG	8 cut(s)	38, 607, 712, 840, 1026, 1387, 1724, 1799
HpySE526I	ACGT	1 cut(s)	379
Hsp92II	CATG	8 cut(s)	127, 242, 796, 1040, 1058, 1097, 1738, 1769
HspAI	GCGC	1 cut(s)	809
Kpn2I	TCCGGA	1 cut(s)	1591
Kzo9I	GATC	4 cut(s)	716, 1294, 1483, 1674
LguI	GCTCTTC	2 cut(s)	196, 421
LmnI	GCTCC	6 cut(s)	820, 841, 1084, 1219, 1242, 1307
LweI	GCATC	2 cut(s)	98, 1066
MaeI	CTAG	3 cut(s)	219, 1161, 1467
MaeII	ACGT	1 cut(s)	379
MaeIII	GTNAC	7 cut(s)	55, 269, 326, 907, 1156, 1457, 1519
MalI	GATC	4 cut(s)	718, 1296, 1485, 1676
MbiI	CCGCTC	1 cut(s)	189
MboI	GATC	4 cut(s)	716, 1294, 1483, 1674
MflI	RGATCY	1 cut(s)	1294
MhlI	GDGCHC	4 cut(s)	829, 1247, 1496, 1805
MlyI	GAGTC	3 cut(s)	594, 1735, 1805
MmeI	TCCRAC	1 cut(s)	478
MroI	TCCGGA	1 cut(s)	1591
MroXI	GAANNNNTTC	2 cut(s)	1358, 1548
MslI	CAYNNNNRTG	1 cut(s)	471
MspA1I	CMGCKG	1 cut(s)	611
MspI	CCGG	5 cut(s)	208, 596, 905, 1351, 1592
MspR9I	CCNGG	3 cut(s)	208, 400, 597
Mva1269I	GAATGC	1 cut(s)	997
MvaI	CCWGG	1 cut(s)	400
MvnI	CGCG	1 cut(s)	282
MwoI	GCNNNNNNNGC	9 cut(s)	239, 568, 746, 773, 833, 892, 977, 1018, 1750
NciI	CCSGG	2 cut(s)	208, 597
NdeII	GATC	4 cut(s)	716, 1294, 1483, 1674
NlaIII	CATG	8 cut(s)	127, 242, 796, 1040, 1058, 1097, 1738, 1769
NlaIV	GGNNCC	5 cut(s)	323, 684, 1062, 1244, 1309
NmeAIII	GCCGAG	1 cut(s)	915
NmuCI	GTSAC	6 cut(s)	269, 326, 907, 1156, 1457, 1519
NspI	RCATGY	2 cut(s)	242, 1738
PaeI	GCATGC	2 cut(s)	242, 1738
PciSI	GCTCTTC	2 cut(s)	196, 421
PcsI	WCGNNNNNNNCGW	1 cut(s)	1615
PctI	GAATGC	1 cut(s)	997
PdmI	GAANNNNTTC	2 cut(s)	1358, 1548
PfeI	GAWTC	3 cut(s)	440, 1415, 1760
PfoI	TCCNGGA	3 cut(s)	206, 398, 595
PinAI	ACCGGT	1 cut(s)	904
PleI	GAGTC	3 cut(s)	593, 1734, 1805
PpsI	GAGTC	3 cut(s)	593, 1734, 1805
PshAI	GACNNNNGTC	1 cut(s)	1656
PshBI	ATTAAT	1 cut(s)	899
Psp124BI	GAGCTC	2 cut(s)	829, 1805
Psp6I	CCWGG	1 cut(s)	398
PspFI	CCCAGC	1 cut(s)	384
PspGI	CCWGG	1 cut(s)	398
PspN4I	GGNNCC	5 cut(s)	323, 684, 1062, 1244, 1309
PspPI	GGNCC	7 cut(s)	184, 277, 322, 367, 1061, 1421, 1571
PstNI	CAGNNNCTG	1 cut(s)	622
PsuI	RGATCY	1 cut(s)	1294
PvuII	CAGCTG	1 cut(s)	611
RsaI	GTAC	2 cut(s)	46, 1567
RsaNI	GTAC	2 cut(s)	45, 1566
RseI	CAYNNNNRTG	1 cut(s)	471
SacI	GAGCTC	2 cut(s)	829, 1805
SapI	GCTCTTC	2 cut(s)	196, 421
Sau3AI	GATC	4 cut(s)	716, 1294, 1483, 1674
Sau96I	GGNCC	7 cut(s)	184, 277, 322, 367, 1061, 1421, 1571
SchI	GAGTC	3 cut(s)	594, 1735, 1805
ScrFI	CCNGG	3 cut(s)	208, 400, 597
SduI	GDGCHC	4 cut(s)	829, 1247, 1496, 1805
SfaNI	GCATC	2 cut(s)	98, 1066
SfcI	CTRYAG	1 cut(s)	244
SinI	GGWCC	4 cut(s)	184, 277, 322, 367
SmiMI	CAYNNNNRTG	1 cut(s)	471
SmlI	CTYRAG	3 cut(s)	866, 881, 1338
SmoI	CTYRAG	3 cut(s)	866, 881, 1338
SphI	GCATGC	2 cut(s)	242, 1738
SsiI	CCGC	5 cut(s)	187, 280, 1230, 1268, 1656
SspI	AATATT	1 cut(s)	1429
SspMI	CTAG	3 cut(s)	219, 1161, 1467
SstI	GAGCTC	2 cut(s)	829, 1805
StyD4I	CCNGG	3 cut(s)	206, 398, 595
StyI	CCWWGG	3 cut(s)	111, 317, 1290
TaaI	ACNGT	7 cut(s)	248, 269, 326, 332, 520, 1397, 1532
TaiI	ACGT	1 cut(s)	382
TaqI	TCGA	1 cut(s)	1729
TatI	WGTACW	1 cut(s)	44
TfiI	GAWTC	3 cut(s)	440, 1415, 1760
TscAI	CASTG	5 cut(s)	58, 762, 838, 1395, 1486
TseFI	GTSAC	6 cut(s)	269, 326, 907, 1156, 1457, 1519
Tsp45I	GTSAC	6 cut(s)	269, 326, 907, 1156, 1457, 1519
TspDTI	ATGAA	4 cut(s)	1004, 1043, 1422, 1715
TspGWI	ACGGA	2 cut(s)	96, 1679
TspRI	CASTG	5 cut(s)	58, 762, 838, 1395, 1486
VpaK11BI	GGWCC	4 cut(s)	184, 277, 322, 367
VspI	ATTAAT	1 cut(s)	899
XapI	RAATTY	3 cut(s)	155, 304, 1639
XceI	RCATGY	2 cut(s)	242, 1738
XmiI	GTMKAC	1 cut(s)	356
XmnI	GAANNNNTTC	2 cut(s)	1358, 1548
XspI	CTAG	3 cut(s)	219, 1161, 1467

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.