Rmu_sc0001408.1_g000021

Apoptosis-inducing factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001408.1
Physical Location & Seq
Reverse (-)
113161 .. 116152
2992 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001408.1_g000021.1.cds

Sequence Viewer

Length: 1092 bp
atggagttgggtggtggagagagaaaacgagtggtggtgatcggaggcggcgttgctggctcgcttctcgcaaaaaatctgcaattcaacgctgatttcaccctcattgatcagaaggaatattttgagattccatgggcaagcttgaggaccatggtggagccatcatttggggagagatctgtgatcaaccatagagattacctcacaaatggccaaattattacatctggagcaatcaatatcactgacactgaagtattgacgggagaaggccgtctaattccctatgactaccttgtcattgccactggccatgcagattctgttcctaaaaccaagactgggaggcttaaggaataccaagaagataatcagaagataagatcagctaattccattttgattgttggaggaggacctactggtgtagagcttgctggagaaattgctactgacttcccagataagaaaatcactctggttcatactggttcaaggttgttggaattcattggaccaaaagctgcaaacaagactcttaattggtttcagtcaaggaatgttgaagtgatactggagcaatcagtcagtttaaacacaatctccgagtcacctggaagcaaaacatatcagacttcagaaggacaaacgtttcacgcagattgtcattttctatgcacagggaaacatgtgggttcagcttggctcaaagaaacagttttgaagggtagcttggatgaatttgggagattaatagttgatgagaatttgagagtcaaagggagaaaaaacgtctttgcagttggagacattactaatattaaagaaatcaagcaagggtatttggcgcaaaaacaggctttggtggctgcaaagaacataaagctcttgcttgaaggaggaagacagagtaagatggcaacttacgaagctcattcggtgctggcacttgtttcacttggaaggaaacatgggcttgcacagttcccatacactacttggattggacgccttcctggactgatcaaatctaaagatctttttgtggggaagacaaggaagcagctggggctactgccacaagattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

363

Amino Acids

39.79

Weight (kDa)

9.17

Isoelectric Point (pI)

31.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 299
AccB7I CCANNNNNTGG 1 cut(s) 170
AciI CCGC 1 cut(s) 48
AclI AACGTT 1 cut(s) 653
AcoI YGGCCR 2 cut(s) 214, 313
AcsI RAATTY 3 cut(s) 509, 743, 769
AcuI CTGAAG 2 cut(s) 276, 624
AcyI GRCGYC 1 cut(s) 1012
AfiI CCNNNNNNNGG 2 cut(s) 170, 345
AflII CTTAAG 1 cut(s) 353
AflIII ACRYGT 1 cut(s) 691
AgsI TTSAA 5 cut(s) 88, 498, 569, 727, 899
AjnI CCWGG 2 cut(s) 616, 1018
AjuI GAANNNNNNNTTGG 2 cut(s) 719, 751
AluBI AGCT 9 cut(s) 144, 392, 436, 527, 704, 735, 889, 935, 1069
AluI AGCT 9 cut(s) 144, 392, 436, 527, 704, 735, 889, 935, 1069
Alw26I GTCTC 1 cut(s) 804
AlwNI CAGNNNCTG 1 cut(s) 326
AoxI GGCC 3 cut(s) 214, 274, 313
ApeKI GCWGC 3 cut(s) 527, 872, 1066
ApoI RAATTY 3 cut(s) 509, 743, 769
AseI ATTAAT 1 cut(s) 755
AspLEI GCGC 1 cut(s) 853
AspS9I GGNCC 3 cut(s) 150, 419, 518
AsuHPI GGTGA 3 cut(s) 49, 91, 606
AvaII GGWCC 3 cut(s) 150, 419, 518
BalI TGGCCA 2 cut(s) 216, 315
BbsI GAAGAC 2 cut(s) 913, 1061
BbvI GCAGC 3 cut(s) 514, 859, 1078
BccI CCATC 2 cut(s) 172, 913
BceAI ACGGC 1 cut(s) 261
BciT130I CCWGG 2 cut(s) 618, 1020
BclI TGATCA 3 cut(s) 109, 186, 1026
BcoDI GTCTC 1 cut(s) 804
BfrI CTTAAG 1 cut(s) 353
BglII AGATCT 2 cut(s) 179, 1039
BisI GCNGC 4 cut(s) 49, 528, 873, 1067
BlsI GCNGC 4 cut(s) 50, 529, 874, 1068
Bme1390I CCNGG 2 cut(s) 618, 1020
Bme18I GGWCC 3 cut(s) 150, 419, 518
BmgT120I GGNCC 3 cut(s) 150, 419, 518
BmiI GGNNCC 1 cut(s) 162
BmrFI CCNGG 2 cut(s) 618, 1020
BmrI ACTGGG 1 cut(s) 354
BmuI ACTGGG 1 cut(s) 354
BpiI GAAGAC 2 cut(s) 913, 1061
BplI GAGNNNNNCTC 2 cut(s) 189, 221
BpmI CTGGAG 3 cut(s) 252, 462, 599
BpuEI CTTGAG 1 cut(s) 166
BsaHI GRCGYC 1 cut(s) 1012
BsaJI CCNNGG 2 cut(s) 134, 153
BsaXI ACNNNNNCTCC 4 cut(s) 36, 66, 590, 620
Bsc4I CCNNNNNNNGG 2 cut(s) 170, 345
Bse1I ACTGG 5 cut(s) 316, 349, 430, 496, 582
Bse3DI GCAATG 1 cut(s) 303
BseBI CCWGG 2 cut(s) 618, 1020
BseDI CCNNGG 2 cut(s) 134, 153
BseGI GGATG 1 cut(s) 745
BseLI CCNNNNNNNGG 2 cut(s) 170, 345
BseMI GCAATG 1 cut(s) 303
BseNI ACTGG 5 cut(s) 316, 349, 430, 496, 582
BseRI GAGGAG 1 cut(s) 429
BseXI GCAGC 3 cut(s) 514, 859, 1078
BseYI CCCAGC 1 cut(s) 1069
BshFI GGCC 3 cut(s) 216, 276, 315
BslI CCNNNNNNNGG 2 cut(s) 170, 345
BsmAI GTCTC 1 cut(s) 804
BsnI GGCC 3 cut(s) 216, 276, 315
Bsp143I GATC 7 cut(s) 39, 109, 179, 186, 386, 1026, 1039
Bsp19I CCATGG 2 cut(s) 134, 153
BspACI CCGC 1 cut(s) 48
BspANI GGCC 3 cut(s) 216, 276, 315
BspLI GGNNCC 1 cut(s) 162
BspTI CTTAAG 1 cut(s) 353
BsrDI GCAATG 1 cut(s) 303
BsrI ACTGG 5 cut(s) 316, 349, 430, 496, 582
BssECI CCNNGG 2 cut(s) 134, 153
BssMI GATC 7 cut(s) 39, 109, 179, 186, 386, 1026, 1039
BssNI GRCGYC 1 cut(s) 1012
BssT1I CCWWGG 2 cut(s) 134, 153
Bst2UI CCWGG 2 cut(s) 618, 1020
Bst4CI ACNGT 2 cut(s) 721, 987
BstACI GRCGYC 1 cut(s) 1012
BstAFI CTTAAG 1 cut(s) 353
BstC8I GCNNGC 6 cut(s) 58, 62, 142, 438, 948, 981
BstDSI CCRYGG 2 cut(s) 134, 153
BstF5I GGATG 1 cut(s) 745
BstHHI GCGC 1 cut(s) 853
BstKTI GATC 7 cut(s) 42, 112, 182, 189, 389, 1029, 1042
BstMAI GTCTC 1 cut(s) 804
BstMBI GATC 7 cut(s) 39, 109, 179, 186, 386, 1026, 1039
BstMWI GCNNNNNNNGC 3 cut(s) 57, 869, 1072
BstNI CCWGG 2 cut(s) 618, 1020
BstNSI RCATGY 1 cut(s) 695
BstSCI CCNGG 2 cut(s) 616, 1018
BstV1I GCAGC 3 cut(s) 514, 859, 1078
BstV2I GAAGAC 2 cut(s) 913, 1061
BstX2I RGATCY 2 cut(s) 179, 1039
BstYI RGATCY 2 cut(s) 179, 1039
BsuRI GGCC 3 cut(s) 216, 276, 315
BtgI CCRYGG 2 cut(s) 134, 153
BtsCI GGATG 1 cut(s) 745
BtsIMutI CAGTG 3 cut(s) 246, 252, 309
Cac8I GCNNGC 6 cut(s) 58, 62, 142, 438, 948, 981
CaiI CAGNNNCTG 1 cut(s) 326
CfoI GCGC 1 cut(s) 853
Cfr13I GGNCC 3 cut(s) 150, 419, 518
CseI GACGC 1 cut(s) 1020
CviAII CATG 5 cut(s) 135, 154, 317, 692, 974
DpnI GATC 7 cut(s) 41, 111, 181, 188, 388, 1028, 1041
DpnII GATC 7 cut(s) 39, 109, 179, 186, 386, 1026, 1039
DraI TTTAAA 1 cut(s) 597
DrdI GACNNNNNNGTC 1 cut(s) 299
DseDI GACNNNNNNGTC 1 cut(s) 299
EaeI YGGCCR 2 cut(s) 214, 313
Eco130I CCWWGG 2 cut(s) 134, 153
Eco47I GGWCC 3 cut(s) 150, 419, 518
Eco57I CTGAAG 2 cut(s) 276, 624
EcoO109I RGGNCCY 1 cut(s) 419
EcoRI GAATTC 1 cut(s) 509
EcoRII CCWGG 2 cut(s) 616, 1018
EcoT14I CCWWGG 2 cut(s) 134, 153
ErhI CCWWGG 2 cut(s) 134, 153
FaeI CATG 5 cut(s) 138, 157, 320, 695, 977
FalI AAGNNNNNCTT 2 cut(s) 719, 751
FatI CATG 5 cut(s) 134, 153, 316, 691, 973
FbaI TGATCA 3 cut(s) 109, 186, 1026
Fnu4HI GCNGC 4 cut(s) 49, 528, 873, 1067
FokI GGATG 1 cut(s) 752
Fsp4HI GCNGC 4 cut(s) 49, 528, 873, 1067
GlaI GCGC 1 cut(s) 852
GluI GCNGC 4 cut(s) 49, 528, 873, 1067
GsaI CCCAGC 1 cut(s) 1073
GsuI CTGGAG 3 cut(s) 252, 462, 599
HaeIII GGCC 3 cut(s) 216, 276, 315
HgaI GACGC 1 cut(s) 1020
HhaI GCGC 1 cut(s) 853
Hin1I GRCGYC 1 cut(s) 1012
Hin1II CATG 5 cut(s) 138, 157, 320, 695, 977
Hin6I GCGC 1 cut(s) 851
HinP1I GCGC 1 cut(s) 851
HindIII AAGCTT 1 cut(s) 142
HinfI GANTC 5 cut(s) 130, 323, 538, 611, 777
HphI GGTGA 3 cut(s) 49, 91, 606
Hpy188I TCNGA 6 cut(s) 44, 114, 378, 610, 636, 643
Hpy188III TCNNGA 1 cut(s) 231
HpyAV CCTTC 7 cut(s) 109, 266, 638, 721, 893, 960, 1025
HpyCH4III ACNGT 2 cut(s) 721, 987
HpyCH4IV ACGT 2 cut(s) 653, 795
HpyCH4V TGCA 7 cut(s) 82, 320, 530, 681, 803, 875, 983
HpyF10VI GCNNNNNNNGC 3 cut(s) 57, 869, 1072
HpySE526I ACGT 2 cut(s) 653, 795
Hsp92I GRCGYC 1 cut(s) 1012
Hsp92II CATG 5 cut(s) 138, 157, 320, 695, 977
HspAI GCGC 1 cut(s) 851
Ksp22I TGATCA 3 cut(s) 109, 186, 1026
Kzo9I GATC 7 cut(s) 39, 109, 179, 186, 386, 1026, 1039
LmnI GCTCC 3 cut(s) 160, 233, 580
Lsp1109I GCAGC 3 cut(s) 514, 859, 1078
MaeII ACGT 2 cut(s) 653, 795
MaeIII GTNAC 1 cut(s) 612
MalI GATC 7 cut(s) 41, 111, 181, 188, 388, 1028, 1041
MboI GATC 7 cut(s) 39, 109, 179, 186, 386, 1026, 1039
MboII GAAGA 4 cut(s) 380, 391, 918, 1066
MflI RGATCY 2 cut(s) 179, 1039
MlsI TGGCCA 2 cut(s) 216, 315
MluCI AATT 9 cut(s) 83, 219, 282, 394, 447, 509, 544, 743, 769
MluNI TGGCCA 2 cut(s) 216, 315
MlyI GAGTC 3 cut(s) 532, 620, 786
MmeI TCCRAC 3 cut(s) 391, 486, 787
MnlI CCTC 8 cut(s) 38, 113, 141, 215, 342, 407, 410, 896
Mox20I TGGCCA 2 cut(s) 216, 315
MscI TGGCCA 2 cut(s) 216, 315
MseI TTAA 6 cut(s) 354, 543, 596, 755, 825, 1090
Msp20I TGGCCA 2 cut(s) 216, 315
MspA1I CMGCKG 1 cut(s) 1069
MspCI CTTAAG 1 cut(s) 353
MspR9I CCNGG 2 cut(s) 618, 1020
MssI GTTTAAAC 1 cut(s) 597
MvaI CCWGG 2 cut(s) 618, 1020
MwoI GCNNNNNNNGC 3 cut(s) 57, 869, 1072
NcoI CCATGG 2 cut(s) 134, 153
NdeII GATC 7 cut(s) 39, 109, 179, 186, 386, 1026, 1039
NlaIII CATG 5 cut(s) 138, 157, 320, 695, 977
NlaIV GGNNCC 1 cut(s) 162
NmuCI GTSAC 1 cut(s) 612
NspI RCATGY 1 cut(s) 695
PciI ACATGT 1 cut(s) 691
PcsI WCGNNNNNNNCGW 1 cut(s) 48
PfeI GAWTC 2 cut(s) 130, 323
PflMI CCANNNNNTGG 1 cut(s) 170
PfoI TCCNGGA 1 cut(s) 1018
PkrI GCNGC 4 cut(s) 50, 529, 874, 1068
PleI GAGTC 3 cut(s) 532, 619, 785
PmeI GTTTAAAC 1 cut(s) 597
PpsI GAGTC 3 cut(s) 532, 619, 785
PpuMI RGGWCCY 1 cut(s) 419
PscI ACATGT 1 cut(s) 691
PshBI ATTAAT 1 cut(s) 755
Psp1406I AACGTT 1 cut(s) 653
Psp5II RGGWCCY 1 cut(s) 419
Psp6I CCWGG 2 cut(s) 616, 1018
PspFI CCCAGC 1 cut(s) 1069
PspGI CCWGG 2 cut(s) 616, 1018
PspN4I GGNNCC 1 cut(s) 162
PspPI GGNCC 3 cut(s) 150, 419, 518
PspPPI RGGWCCY 1 cut(s) 419
PstNI CAGNNNCTG 1 cut(s) 326
PsuI RGATCY 2 cut(s) 179, 1039
PvuII CAGCTG 1 cut(s) 1069
SaqAI TTAA 6 cut(s) 354, 543, 596, 755, 825, 1090
SatI GCNGC 4 cut(s) 49, 528, 873, 1067
Sau3AI GATC 7 cut(s) 39, 109, 179, 186, 386, 1026, 1039
Sau96I GGNCC 3 cut(s) 150, 419, 518
SchI GAGTC 3 cut(s) 532, 620, 786
ScrFI CCNGG 2 cut(s) 618, 1020
SinI GGWCC 3 cut(s) 150, 419, 518
SmlI CTYRAG 2 cut(s) 145, 353
SmoI CTYRAG 2 cut(s) 145, 353
Sse9I AATT 9 cut(s) 83, 219, 282, 394, 447, 509, 544, 743, 769
SsiI CCGC 1 cut(s) 48
SspI AATATT 2 cut(s) 122, 823
StyD4I CCNGG 2 cut(s) 616, 1018
StyI CCWWGG 2 cut(s) 134, 153
TaaI ACNGT 2 cut(s) 721, 987
TaiI ACGT 2 cut(s) 656, 798
TasI AATT 9 cut(s) 83, 219, 282, 394, 447, 509, 544, 743, 769
TauI GCSGC 1 cut(s) 51
TfiI GAWTC 2 cut(s) 130, 323
Tru1I TTAA 6 cut(s) 354, 543, 596, 755, 825, 1090
Tru9I TTAA 6 cut(s) 354, 543, 596, 755, 825, 1090
TscAI CASTG 3 cut(s) 253, 259, 316
TseFI GTSAC 1 cut(s) 612
TseI GCWGC 3 cut(s) 527, 872, 1066
Tsp45I GTSAC 1 cut(s) 612
TspDTI ATGAA 3 cut(s) 476, 502, 756
TspRI CASTG 3 cut(s) 253, 259, 316
Van91I CCANNNNNTGG 1 cut(s) 170
Vha464I CTTAAG 1 cut(s) 353
VpaK11BI GGWCC 3 cut(s) 150, 419, 518
VspI ATTAAT 1 cut(s) 755
XapI RAATTY 3 cut(s) 509, 743, 769
XceI RCATGY 1 cut(s) 695
XcmI CCANNNNNNNNNTGG 1 cut(s) 999
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.