Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001421.1

Orthogroup ID

OG0016683

Physical Location & Seq

Genomic Coordinates Forward (+)

21702 .. 22910

Gene Structure 1209 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001421.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1209 bp

atggatgataagtttcccaagatggaaaccttcatcccaaagcagtttccatattttccaggaatggcaagtagtaccggatcgaattttctcggtgatccggccggttgggaagtcggtggattaaaatcatcactgtcaccagagtctagcacttcttcttcagcaggtgaagtttctgataactccactttgataaacaaaacaaatccagttgtccctgtgaatttccttgaaacatttcctgtgcttaacaaagctcatgtttctgatcaaccacctacttctccagcttccttgtcatcaaagccatcaaatttcccaaatttaactctacttttgcaggaaccaactacccttttagatccatcatcacccaaaaagtgtgatgagtccatgttctcctctttaagcccctcatttcctatacctcaccttgagcactgtcaaccagactttgatcaatggctcaaaatcagtcaaactctagcaaaaaatccatctaaaggtttcaatgattactggctaagtgcgacgaaaacacagccaatgaagtccagtggaagatcaagatttcagaatcaacaacagaagcagccatcagcaccaatcccatcgtcacaaggaaagctatttagaggagtgaggcaaaggcattggggaaaatgggtggctgagattagattaccgagaaacagaacaagggtttggttggggactttcgacaaagctgaggaggctgcaagtgcttatgacactgctgcctatatgctccgtggcgaatatgctcatttgaactttccagattcaaaacatcaactcaaggccaatgctttgaatgggaatacaagcactacagctgccctgcttgaagccaagttacaactagcaatatcacaacaggcaaataagaagacgaatattatggagtcatcgtcttcatcatcacctccatcaccaaaaaagaagaagcactcatcagccgatgatcgtcatcagaagaactcaaattccatcatcaatagtaatttgatcagccaaaaccaaattacaagaaaagagtggcagcttggatctgatcaggtgatatttgaaagcaagaaaagccaggatgtaatatcatcatcagatatggatgctgttcagctaagtagaatgccatctttggacatggacatgatatgggatgctcttctggtctctgattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003700 GO:0006355 GO:0008150 GO:0009889 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0031323 GO:0031326 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090 GO:0140110 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AP2

Protein Analysis

402

Amino Acids

44.47

Weight (kDa)

8.97

Isoelectric Point (pI)

54.45

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016683)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G13620
malus_domestica	MD04G1009000.v1.1
prunus_persica	Prupe.1G008400_v2.0.a1
pyrus_communis	pycom04g00700
rosa_chinensis	RchiOBHm_Chr4g0415231
rosa_laevigata	RLG00000008088
rosa_multiflora	Rmu_sc0001421.1_g000007
rosa_roxburghii	Rroxscaffold_5G00359040
rosa_rugosa	Rorug04G0132500
rosa_samantha	Rh4AG193100 Rh4BG191500 Rh4CG204200 Rh4DG191000
rosa_wichuraiana	Rw4G016420

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	158
Acc36I	ACCTGC	1 cut(s)	158
AclWI	GGATC	4 cut(s)	88, 92, 359, 1081
AcoI	YGGCCR	1 cut(s)	102
AcsI	RAATTY	5 cut(s)	85, 226, 316, 325, 1009
AcuI	CTGAAG	1 cut(s)	147
AfaI	GTAC	1 cut(s)	76
AfiI	CCNNNNNNNGG	1 cut(s)	506
AgsI	TTSAA	7 cut(s)	236, 514, 796, 810, 838, 872, 1094
AjnI	CCWGG	2 cut(s)	58, 1107
AjuI	GAANNNNNNNTTGG	2 cut(s)	691, 723
AloI	GAACNNNNNNTCC	2 cut(s)	995, 1027
AluBI	AGCT	7 cut(s)	260, 293, 631, 731, 860, 1069, 1147
AluI	AGCT	7 cut(s)	260, 293, 631, 731, 860, 1069, 1147
Alw21I	GWGCWC	1 cut(s)	444
Alw26I	GTCTC	1 cut(s)	1204
AlwI	GGATC	4 cut(s)	88, 92, 359, 1081
AoxI	GGCC	2 cut(s)	102, 825
ApeKI	GCWGC	5 cut(s)	595, 740, 761, 860, 1066
ApoI	RAATTY	5 cut(s)	85, 226, 316, 325, 1009
Asp700I	GAANNNNTTC	1 cut(s)	240
AsuHPI	GGTGA	8 cut(s)	107, 132, 182, 366, 425, 939, 948, 1096
BarI	GAAGNNNNNNTAC	2 cut(s)	864, 896
BbsI	GAAGAC	2 cut(s)	920, 930
Bbv12I	GWGCWC	1 cut(s)	444
BbvCI	CCTCAGC	1 cut(s)	732
BbvI	GCAGC	5 cut(s)	607, 727, 748, 847, 1078
BccI	CCATC	9 cut(s)	16, 319, 376, 508, 607, 622, 961, 1022, 1168
BciT130I	CCWGG	2 cut(s)	60, 1109
BclI	TGATCA	4 cut(s)	271, 460, 1032, 1078
BcoDI	GTCTC	1 cut(s)	1204
BfaI	CTAG	3 cut(s)	150, 488, 887
BfmI	CTRYAG	1 cut(s)	855
BfuAI	ACCTGC	1 cut(s)	158
BisI	GCNGC	5 cut(s)	596, 741, 762, 861, 1067
BlsI	GCNGC	5 cut(s)	597, 742, 763, 862, 1068
Bme1390I	CCNGG	2 cut(s)	60, 1109
BmiI	GGNNCC	1 cut(s)	348
BmrFI	CCNGG	2 cut(s)	60, 1109
BmsI	GCATC	2 cut(s)	1126, 1177
BpiI	GAAGAC	2 cut(s)	920, 930
BpmI	CTGGAG	1 cut(s)	273
Bpu10I	CCTNAGC	1 cut(s)	732
BpuEI	CTTGAG	2 cut(s)	458, 806
BsaBI	GATNNNNATC	2 cut(s)	127, 993
BsaI	GGTCTC	1 cut(s)	1204
BsaJI	CCNNGG	1 cut(s)	775
BsaWI	WCCGGW	1 cut(s)	77
BsaXI	ACNNNNNCTCC	2 cut(s)	920, 950
Bsc4I	CCNNNNNNNGG	1 cut(s)	506
Bse118I	RCCGGY	1 cut(s)	104
Bse1I	ACTGG	3 cut(s)	212, 527, 558
Bse8I	GATNNNNATC	2 cut(s)	127, 993
BseBI	CCWGG	2 cut(s)	60, 1109
BseDI	CCNNGG	1 cut(s)	775
BseGI	GGATG	5 cut(s)	10, 33, 1117, 1141, 1192
BseJI	GATNNNNATC	2 cut(s)	127, 993
BseLI	CCNNNNNNNGG	1 cut(s)	506
BseMII	CTCAG	2 cut(s)	666, 723
BseNI	ACTGG	3 cut(s)	212, 527, 558
BseRI	GAGGAG	3 cut(s)	394, 654, 749
BseX3I	CGGCCG	1 cut(s)	102
BseXI	GCAGC	5 cut(s)	607, 727, 748, 847, 1078
Bsh1285I	CGRYCG	1 cut(s)	105
BshFI	GGCC	2 cut(s)	104, 827
BsiEI	CGRYCG	1 cut(s)	105
BsiHKAI	GWGCWC	1 cut(s)	444
BsiSI	CCGG	3 cut(s)	78, 101, 105
BslFI	GGGAC	2 cut(s)	203, 730
BslI	CCNNNNNNNGG	1 cut(s)	506
BsmAI	GTCTC	1 cut(s)	1204
BsmFI	GGGAC	2 cut(s)	203, 730
BsmI	GAATGC	1 cut(s)	1161
BsnI	GGCC	2 cut(s)	104, 827
Bso31I	GGTCTC	1 cut(s)	1204
Bsp1286I	GDGCHC	1 cut(s)	444
BspANI	GGCC	2 cut(s)	104, 827
BspCNI	CTCAG	2 cut(s)	667, 724
BspLI	GGNNCC	1 cut(s)	348
BspMI	ACCTGC	1 cut(s)	158
BspPI	GGATC	4 cut(s)	88, 92, 359, 1081
BspQI	GCTCTTC	1 cut(s)	1197
BspTNI	GGTCTC	1 cut(s)	1204
BsrFI	RCCGGY	1 cut(s)	104
BsrI	ACTGG	3 cut(s)	212, 527, 558
BssAI	RCCGGY	1 cut(s)	104
BssECI	CCNNGG	1 cut(s)	775
Bst2UI	CCWGG	2 cut(s)	60, 1109
Bst4CI	ACNGT	2 cut(s)	138, 446
Bst6I	CTCTTC	1 cut(s)	1197
BstDEI	CTNAG	4 cut(s)	527, 675, 732, 1148
BstDSI	CCRYGG	1 cut(s)	775
BstF5I	GGATG	5 cut(s)	10, 33, 1117, 1141, 1192
BstMAI	GTCTC	1 cut(s)	1204
BstMCI	CGRYCG	1 cut(s)	105
BstMWI	GCNNNNNNNGC	3 cut(s)	737, 746, 1104
BstNI	CCWGG	2 cut(s)	60, 1109
BstSCI	CCNGG	2 cut(s)	58, 1107
BstSFI	CTRYAG	1 cut(s)	855
BstV1I	GCAGC	5 cut(s)	607, 727, 748, 847, 1078
BstV2I	GAAGAC	2 cut(s)	920, 930
BstX2I	RGATCY	2 cut(s)	364, 1073
BstYI	RGATCY	2 cut(s)	364, 1073
BstZI	CGGCCG	1 cut(s)	102
BsuRI	GGCC	2 cut(s)	104, 827
BtgI	CCRYGG	1 cut(s)	775
BtsCI	GGATG	5 cut(s)	10, 33, 1117, 1141, 1192
BtsI	GCAGTG	1 cut(s)	756
BtsIMutI	CAGTG	4 cut(s)	134, 442, 565, 756
BveI	ACCTGC	1 cut(s)	158
Cfr10I	RCCGGY	1 cut(s)	104
Csp6I	GTAC	1 cut(s)	75
CviAII	CATG	4 cut(s)	263, 397, 1171, 1177
CviQI	GTAC	1 cut(s)	75
DdeI	CTNAG	4 cut(s)	527, 675, 732, 1148
EaeI	YGGCCR	1 cut(s)	102
EagI	CGGCCG	1 cut(s)	102
Eam1104I	CTCTTC	1 cut(s)	1197
EarI	CTCTTC	1 cut(s)	1197
EclXI	CGGCCG	1 cut(s)	102
Eco31I	GGTCTC	1 cut(s)	1204
Eco52I	CGGCCG	1 cut(s)	102
Eco57I	CTGAAG	1 cut(s)	147
EcoRII	CCWGG	2 cut(s)	58, 1107
FaeI	CATG	4 cut(s)	266, 400, 1174, 1180
FaqI	GGGAC	2 cut(s)	203, 730
FatI	CATG	4 cut(s)	262, 396, 1170, 1176
FbaI	TGATCA	4 cut(s)	271, 460, 1032, 1078
Fnu4HI	GCNGC	5 cut(s)	596, 741, 762, 861, 1067
FokI	GGATG	5 cut(s)	17, 20, 1124, 1148, 1199
Fsp4HI	GCNGC	5 cut(s)	596, 741, 762, 861, 1067
FspBI	CTAG	3 cut(s)	150, 488, 887
GluI	GCNGC	5 cut(s)	596, 741, 762, 861, 1067
GsuI	CTGGAG	1 cut(s)	273
HaeIII	GGCC	2 cut(s)	104, 827
HapII	CCGG	3 cut(s)	78, 101, 105
Hin1II	CATG	4 cut(s)	266, 400, 1174, 1180
HincII	GTYRAC	1 cut(s)	449
HindII	GTYRAC	1 cut(s)	449
HinfI	GANTC	5 cut(s)	146, 392, 580, 806, 929
HpaII	CCGG	3 cut(s)	78, 101, 105
HphI	GGTGA	8 cut(s)	107, 132, 182, 366, 425, 939, 948, 1096
Hpy166II	GTNNAC	1 cut(s)	449
Hpy188I	TCNGA	7 cut(s)	181, 271, 579, 999, 1078, 1129, 1204
Hpy188III	TCNNGA	2 cut(s)	570, 803
Hpy8I	GTNNAC	1 cut(s)	449
Hpy99I	CGWCG	1 cut(s)	538
HpyAV	CCTTC	1 cut(s)	40
HpyCH4III	ACNGT	2 cut(s)	138, 446
HpyCH4V	TGCA	2 cut(s)	343, 743
HpyF10VI	GCNNNNNNNGC	3 cut(s)	737, 746, 1104
HpyF3I	CTNAG	4 cut(s)	527, 675, 732, 1148
Hsp92II	CATG	4 cut(s)	266, 400, 1174, 1180
Ksp22I	TGATCA	4 cut(s)	271, 460, 1032, 1078
LguI	GCTCTTC	1 cut(s)	1197
LmnI	GCTCC	1 cut(s)	777
Lsp1109I	GCAGC	5 cut(s)	607, 727, 748, 847, 1078
LweI	GCATC	2 cut(s)	1126, 1177
MaeI	CTAG	3 cut(s)	150, 488, 887
MaeIII	GTNAC	3 cut(s)	138, 618, 879
MboII	GAAGA	8 cut(s)	150, 153, 576, 925, 930, 979, 1012, 1184
MflI	RGATCY	2 cut(s)	364, 1073
MhlI	GDGCHC	1 cut(s)	444
MluCI	AATT	7 cut(s)	85, 226, 316, 325, 1009, 1027, 1047
MlyI	GAGTC	3 cut(s)	155, 401, 938
MnlI	CCTC	8 cut(s)	415, 427, 441, 632, 639, 727, 730, 960
MroXI	GAANNNNTTC	1 cut(s)	240
MseI	TTAA	5 cut(s)	125, 252, 329, 410, 1207
MslI	CAYNNNNRTG	1 cut(s)	1175
MspA1I	CMGCKG	1 cut(s)	860
MspI	CCGG	3 cut(s)	78, 101, 105
MspR9I	CCNGG	2 cut(s)	60, 1109
Mva1269I	GAATGC	1 cut(s)	1161
MvaI	CCWGG	2 cut(s)	60, 1109
MwoI	GCNNNNNNNGC	3 cut(s)	737, 746, 1104
NlaIII	CATG	4 cut(s)	266, 400, 1174, 1180
NlaIV	GGNNCC	1 cut(s)	348
NmuCI	GTSAC	2 cut(s)	138, 618
PaqCI	CACCTGC	1 cut(s)	158
PciSI	GCTCTTC	1 cut(s)	1197
PctI	GAATGC	1 cut(s)	1161
PdmI	GAANNNNTTC	1 cut(s)	240
PfeI	GAWTC	2 cut(s)	580, 806
PfoI	TCCNGGA	1 cut(s)	58
PkrI	GCNGC	5 cut(s)	597, 742, 763, 862, 1068
PleI	GAGTC	3 cut(s)	154, 400, 937
PpsI	GAGTC	3 cut(s)	154, 400, 937
Psp6I	CCWGG	2 cut(s)	58, 1107
PspGI	CCWGG	2 cut(s)	58, 1107
PspN4I	GGNNCC	1 cut(s)	348
PsuI	RGATCY	2 cut(s)	364, 1073
PvuII	CAGCTG	1 cut(s)	860
RsaI	GTAC	1 cut(s)	76
RsaNI	GTAC	1 cut(s)	75
RseI	CAYNNNNRTG	1 cut(s)	1175
SapI	GCTCTTC	1 cut(s)	1197
SaqAI	TTAA	5 cut(s)	125, 252, 329, 410, 1207
SatI	GCNGC	5 cut(s)	596, 741, 762, 861, 1067
SchI	GAGTC	3 cut(s)	155, 401, 938
ScrFI	CCNGG	2 cut(s)	60, 1109
SduI	GDGCHC	1 cut(s)	444
SfaNI	GCATC	2 cut(s)	1126, 1177
SfcI	CTRYAG	1 cut(s)	855
SmiMI	CAYNNNNRTG	1 cut(s)	1175
SmlI	CTYRAG	2 cut(s)	437, 821
SmoI	CTYRAG	2 cut(s)	437, 821
Sse9I	AATT	7 cut(s)	85, 226, 316, 325, 1009, 1027, 1047
SspI	AATATT	1 cut(s)	922
SspMI	CTAG	3 cut(s)	150, 488, 887
StyD4I	CCNGG	2 cut(s)	58, 1107
TaaI	ACNGT	2 cut(s)	138, 446
TaqI	TCGA	2 cut(s)	83, 723
TasI	AATT	7 cut(s)	85, 226, 316, 325, 1009, 1027, 1047
TfiI	GAWTC	2 cut(s)	580, 806
Tru1I	TTAA	5 cut(s)	125, 252, 329, 410, 1207
Tru9I	TTAA	5 cut(s)	125, 252, 329, 410, 1207
TscAI	CASTG	4 cut(s)	141, 449, 565, 763
TseFI	GTSAC	2 cut(s)	138, 618
TseI	GCWGC	5 cut(s)	595, 740, 761, 860, 1066
Tsp45I	GTSAC	2 cut(s)	138, 618
TspDTI	ATGAA	3 cut(s)	22, 566, 930
TspGWI	ACGGA	1 cut(s)	764
TspRI	CASTG	4 cut(s)	141, 449, 565, 763
XapI	RAATTY	5 cut(s)	85, 226, 316, 325, 1009
XmnI	GAANNNNTTC	1 cut(s)	240
XspI	CTAG	3 cut(s)	150, 488, 887

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.