Rmu_sc0001659.1_g000045

SAM dependent carboxyl methyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001659.1
OG0016697
Physical Location & Seq
Forward (+)
173802 .. 175562
1761 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001659.1_g000045.1.cds

Sequence Viewer

Length: 1089 bp
atggatgtagagaaagtctttcacatgactggaggcattggccacaacagctatgcaaaaaactcttccctccaaaagaaggcttctgatctggtcaaggacatgaccttagaaacagtccaagaactttaccttacaacagctccaaagagcttaggcatagctgatctgggttgctcatcaggacccaacaccttgtcaatcatgaaagagatcattgaagcagtccaaggaacaagtagaaaagccttccacacagcaccagaattcagagtgtaccttaatgatcttcccaccaatgacttcaactcaattttcaagtccttgccagagttctcaagggacctcaacaaagaaacgaacagtgggcctccttccatttatataggaggttatccaggctcattttatgggagacttttccccaacaactccttgcactttgtatattcatcttacagtttacactggctgtctagggttcctccggctatttactcagagcaagggaagtccttaaacaaaggcagtgtttacatttctgaatcaagccctcttgtagtggctgacgcatacttgaagcaattccaggaagacttcactttgtttcttcagtcaaggtctgaggagttgatttcaggaggaaaaatgatgctgatcttgttgggcaggatcggcccagatcatgtggacagaggcaactctttcttctgggagcttctttatcagtccattgccattttggtttccaagggagaagttgagaaggaaaagctggattcatatgatgtgcatttctatgctccatccaaagatgaattagaagatgcagtgaggaaagagggttcttttggattggacaggttcgagatgtttgagttagagagggacaatcacaaggacaatgagagctatgcaacaagcgttgcaatgaccgtaagggctattcaagaatcaatgattggccaacactttggagaagaaatcttggacagtttatttgagaactatagaagattggtaggcgaagaaattgccaaagaagacattaagcctattacttttgggcttgtacttagaaaactatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Methyltransf_7

Protein Analysis

362

Amino Acids

40.82

Weight (kDa)

5.25

Isoelectric Point (pI)

44.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016697)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G36470
fragaria_vesca FvH4_1g12770
malus_domestica MD15G1256500.v1.1
prunus_persica Prupe.7G158400_v2.0.a1 Prupe.7G158400_v2.0.a1
pyrus_communis pycom02g11320 pycom15g22440
rosa_chinensis RchiOBHm_Chr2g0100891
rosa_laevigata RLG00000017021
rosa_multiflora Rmu_sc0001659.1_g000045
rosa_roxburghii Rroxscaffold_2G00141760
rosa_rugosa Rorug02G0093400
rosa_samantha Rh2BG146100
rosa_wichuraiana Rw2G011060

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 680
AcoI YGGCCR 2 cut(s) 40, 964
AcsI RAATTY 1 cut(s) 266
AcuI CTGAAG 1 cut(s) 596
AfaI GTAC 2 cut(s) 278, 1074
AfiI CCNNNNNNNGG 1 cut(s) 79
AgsI TTSAA 5 cut(s) 221, 307, 319, 580, 950
AjnI CCWGG 2 cut(s) 397, 588
AjuI GAANNNNNNNTTGG 2 cut(s) 945, 977
AloI GAACNNNNNNTCC 2 cut(s) 829, 861
AluBI AGCT 7 cut(s) 51, 143, 153, 164, 718, 775, 912
AluI AGCT 7 cut(s) 51, 143, 153, 164, 718, 775, 912
Alw26I GTCTC 1 cut(s) 409
AlwI GGATC 1 cut(s) 680
AoxI GGCC 4 cut(s) 40, 368, 676, 964
ApoI RAATTY 1 cut(s) 266
ArsI GACNNNNNNTTYG 2 cut(s) 983, 1015
Asp700I GAANNNNTTC 1 cut(s) 584
AspS9I GGNCC 4 cut(s) 185, 343, 368, 677
AvaII GGWCC 2 cut(s) 185, 343
BalI TGGCCA 2 cut(s) 42, 966
BbsI GAAGAC 2 cut(s) 600, 1050
BccI CCATC 1 cut(s) 814
BcgI CGANNNNNNTGC 2 cut(s) 1016, 1050
BciT130I CCWGG 2 cut(s) 399, 590
BcoDI GTCTC 1 cut(s) 409
BfaI CTAG 1 cut(s) 477
BfmI CTRYAG 1 cut(s) 1009
Bme1390I CCNGG 2 cut(s) 399, 590
Bme18I GGWCC 2 cut(s) 185, 343
BmgT120I GGNCC 4 cut(s) 185, 343, 368, 677
BmiI GGNNCC 3 cut(s) 187, 344, 483
BmrFI CCNGG 2 cut(s) 399, 590
BmsI GCATC 2 cut(s) 642, 817
BpiI GAAGAC 2 cut(s) 600, 1050
BpmI CTGGAG 1 cut(s) 51
Bpu10I CCTNAGC 1 cut(s) 154
BpuEI CTTGAG 1 cut(s) 322
BsaBI GATNNNNATC 1 cut(s) 656
BsaJI CCNNGG 2 cut(s) 229, 750
BsaXI ACNNNNNCTCC 2 cut(s) 127, 157
Bsc4I CCNNNNNNNGG 1 cut(s) 79
Bse1I ACTGG 2 cut(s) 34, 473
Bse3DI GCAATG 2 cut(s) 732, 936
Bse8I GATNNNNATC 1 cut(s) 656
BseBI CCWGG 2 cut(s) 399, 590
BseDI CCNNGG 2 cut(s) 229, 750
BseGI GGATG 2 cut(s) 10, 806
BseJI GATNNNNATC 1 cut(s) 656
BseLI CCNNNNNNNGG 1 cut(s) 79
BseMI GCAATG 2 cut(s) 732, 936
BseMII CTCAG 2 cut(s) 513, 615
BseNI ACTGG 2 cut(s) 34, 473
BseRI GAGGAG 1 cut(s) 641
BshFI GGCC 4 cut(s) 42, 370, 678, 966
BsiSI CCGG 1 cut(s) 488
BslFI GGGAC 2 cut(s) 356, 902
BslI CCNNNNNNNGG 1 cut(s) 79
BsmAI GTCTC 1 cut(s) 409
BsmFI GGGAC 2 cut(s) 356, 902
BsnI GGCC 4 cut(s) 42, 370, 678, 966
Bsp143I GATC 7 cut(s) 88, 166, 213, 286, 657, 672, 682
BspANI GGCC 4 cut(s) 42, 370, 678, 966
BspCNI CTCAG 2 cut(s) 512, 616
BspHI TCATGA 1 cut(s) 204
BspLI GGNNCC 3 cut(s) 187, 344, 483
BspPI GGATC 1 cut(s) 680
BsrDI GCAATG 2 cut(s) 732, 936
BsrI ACTGG 2 cut(s) 34, 473
BssECI CCNNGG 2 cut(s) 229, 750
BssMI GATC 7 cut(s) 88, 166, 213, 286, 657, 672, 682
BssT1I CCWWGG 2 cut(s) 229, 750
Bst2UI CCWGG 2 cut(s) 399, 590
Bst4CI ACNGT 5 cut(s) 118, 365, 461, 937, 995
Bst6I CTCTTC 1 cut(s) 70
BstDEI CTNAG 5 cut(s) 109, 154, 499, 624, 1076
BstF5I GGATG 2 cut(s) 10, 806
BstKTI GATC 7 cut(s) 91, 169, 216, 289, 660, 675, 685
BstMAI GTCTC 1 cut(s) 409
BstMBI GATC 7 cut(s) 88, 166, 213, 286, 657, 672, 682
BstMWI GCNNNNNNNGC 2 cut(s) 48, 675
BstNI CCWGG 2 cut(s) 399, 590
BstSCI CCNGG 2 cut(s) 397, 588
BstSFI CTRYAG 1 cut(s) 1009
BstV2I GAAGAC 2 cut(s) 600, 1050
BstXI CCANNNNNNTGG 1 cut(s) 974
BsuRI GGCC 4 cut(s) 42, 370, 678, 966
BtsCI GGATG 2 cut(s) 10, 806
BtsI GCAGTG 2 cut(s) 535, 837
BtsIMutI CAGTG 4 cut(s) 370, 466, 535, 837
CciI TCATGA 1 cut(s) 204
Cfr13I GGNCC 4 cut(s) 185, 343, 368, 677
CseI GACGC 1 cut(s) 578
Csp6I GTAC 2 cut(s) 277, 1073
CviAII CATG 4 cut(s) 25, 103, 205, 686
CviQI GTAC 2 cut(s) 277, 1073
DdeI CTNAG 5 cut(s) 109, 154, 499, 624, 1076
DpnI GATC 7 cut(s) 90, 168, 215, 288, 659, 674, 684
DpnII GATC 7 cut(s) 88, 166, 213, 286, 657, 672, 682
EaeI YGGCCR 2 cut(s) 40, 964
Eam1104I CTCTTC 1 cut(s) 70
EarI CTCTTC 1 cut(s) 70
Eco130I CCWWGG 2 cut(s) 229, 750
Eco47I GGWCC 2 cut(s) 185, 343
Eco57I CTGAAG 1 cut(s) 596
EcoO109I RGGNCCY 2 cut(s) 185, 343
EcoRI GAATTC 1 cut(s) 266
EcoRII CCWGG 2 cut(s) 397, 588
EcoT14I CCWWGG 2 cut(s) 229, 750
ErhI CCWWGG 2 cut(s) 229, 750
FaeI CATG 4 cut(s) 28, 106, 208, 689
FaqI GGGAC 2 cut(s) 356, 902
FatI CATG 4 cut(s) 24, 102, 204, 685
FauNDI CATATG 1 cut(s) 784
FokI GGATG 2 cut(s) 17, 793
FspBI CTAG 1 cut(s) 477
GsuI CTGGAG 1 cut(s) 51
HaeIII GGCC 4 cut(s) 42, 370, 678, 966
HapII CCGG 1 cut(s) 488
HgaI GACGC 1 cut(s) 578
Hin1II CATG 4 cut(s) 28, 106, 208, 689
HinfI GANTC 3 cut(s) 545, 779, 953
HpaII CCGG 1 cut(s) 488
Hpy166II GTNNAC 4 cut(s) 277, 464, 535, 691
Hpy188I TCNGA 5 cut(s) 88, 272, 502, 544, 625
Hpy188III TCNNGA 5 cut(s) 183, 205, 639, 868, 950
Hpy8I GTNNAC 4 cut(s) 277, 464, 535, 691
HpyAV CCTTC 4 cut(s) 73, 259, 384, 760
HpyCH4III ACNGT 5 cut(s) 118, 365, 461, 937, 995
HpyCH4V TGCA 6 cut(s) 56, 439, 793, 830, 917, 929
HpyF10VI GCNNNNNNNGC 2 cut(s) 48, 675
HpyF3I CTNAG 5 cut(s) 109, 154, 499, 624, 1076
Hsp92II CATG 4 cut(s) 28, 106, 208, 689
Kzo9I GATC 7 cut(s) 88, 166, 213, 286, 657, 672, 682
LmnI GCTCC 3 cut(s) 148, 715, 808
LweI GCATC 2 cut(s) 642, 817
MaeI CTAG 1 cut(s) 477
MalI GATC 7 cut(s) 90, 168, 215, 288, 659, 674, 684
MboI GATC 7 cut(s) 88, 166, 213, 286, 657, 672, 682
MlsI TGGCCA 2 cut(s) 42, 966
MluCI AATT 5 cut(s) 266, 312, 584, 818, 1032
MluNI TGGCCA 2 cut(s) 42, 966
Mox20I TGGCCA 2 cut(s) 42, 966
MroXI GAANNNNTTC 1 cut(s) 584
MscI TGGCCA 2 cut(s) 42, 966
MseI TTAA 3 cut(s) 282, 518, 1050
MslI CAYNNNNRTG 1 cut(s) 798
Msp20I TGGCCA 2 cut(s) 42, 966
MspI CCGG 1 cut(s) 488
MspR9I CCNGG 2 cut(s) 399, 590
MvaI CCWGG 2 cut(s) 399, 590
MwoI GCNNNNNNNGC 2 cut(s) 48, 675
NdeI CATATG 1 cut(s) 784
NdeII GATC 7 cut(s) 88, 166, 213, 286, 657, 672, 682
NlaIII CATG 4 cut(s) 28, 106, 208, 689
NlaIV GGNNCC 3 cut(s) 187, 344, 483
PagI TCATGA 1 cut(s) 204
PdmI GAANNNNTTC 1 cut(s) 584
PfeI GAWTC 3 cut(s) 545, 779, 953
PfoI TCCNGGA 1 cut(s) 588
PpuMI RGGWCCY 2 cut(s) 185, 343
Psp5II RGGWCCY 2 cut(s) 185, 343
Psp6I CCWGG 2 cut(s) 397, 588
PspGI CCWGG 2 cut(s) 397, 588
PspN4I GGNNCC 3 cut(s) 187, 344, 483
PspPI GGNCC 4 cut(s) 185, 343, 368, 677
PspPPI RGGWCCY 2 cut(s) 185, 343
RsaI GTAC 2 cut(s) 278, 1074
RsaNI GTAC 2 cut(s) 277, 1073
RseI CAYNNNNRTG 1 cut(s) 798
SaqAI TTAA 3 cut(s) 282, 518, 1050
Sau3AI GATC 7 cut(s) 88, 166, 213, 286, 657, 672, 682
Sau96I GGNCC 4 cut(s) 185, 343, 368, 677
ScrFI CCNGG 2 cut(s) 399, 590
SfaNI GCATC 2 cut(s) 642, 817
SfcI CTRYAG 1 cut(s) 1009
SinI GGWCC 2 cut(s) 185, 343
SmiMI CAYNNNNRTG 1 cut(s) 798
SmlI CTYRAG 1 cut(s) 337
SmoI CTYRAG 1 cut(s) 337
Sse9I AATT 5 cut(s) 266, 312, 584, 818, 1032
SspMI CTAG 1 cut(s) 477
StyD4I CCNGG 2 cut(s) 397, 588
StyI CCWWGG 2 cut(s) 229, 750
TaaI ACNGT 5 cut(s) 118, 365, 461, 937, 995
TaqI TCGA 1 cut(s) 867
TasI AATT 5 cut(s) 266, 312, 584, 818, 1032
TatI WGTACW 1 cut(s) 1072
TfiI GAWTC 3 cut(s) 545, 779, 953
Tru1I TTAA 3 cut(s) 282, 518, 1050
Tru9I TTAA 3 cut(s) 282, 518, 1050
TscAI CASTG 4 cut(s) 370, 473, 535, 837
TspDTI ATGAA 4 cut(s) 221, 441, 771, 831
TspRI CASTG 4 cut(s) 370, 473, 535, 837
VpaK11BI GGWCC 2 cut(s) 185, 343
XapI RAATTY 1 cut(s) 266
XcmI CCANNNNNNNNNTGG 1 cut(s) 739
XmnI GAANNNNTTC 1 cut(s) 584
XspI CTAG 1 cut(s) 477
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.