Rmu_sc0001685.1_g000014

PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001685.1
Physical Location & Seq
Forward (+)
64689 .. 66940
2252 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001685.1_g000014.1.cds

Sequence Viewer

Length: 696 bp
atgtggagccgaaagtcagctctgatcggagttttgggttgcctttgtatctacacaacatttcttaccagcgtcatagcttcgtctcaggaatctctgctcggatccgcccgcgtcgtttttcagaccaattttggggacattgaatttgggttcttcccaggagttgctcccaaaaccgttgaccacattttcaagctggtccgtctaggttgctataacaccaaccacttctttagggtcgacaagggttttgtggcccaagtcgccgacgtggtcagcggaagatcggccccgatgaacgagcagcaaagagcagaagcggagaagaccgtggtgggtgaattcagtgatgtgaaacatgtcagaggcattctatcaatgggaagatatgaagacccaaatagtgcggcttcctcattttcgatgcttcttggagatgcgcctcatcttgatggtcagtacgcaatatttggtaaagtgactagaggtgatgagactttgagaaagcttgaggaagtccctactcgtcgcgagggaatttttgtaatgccgaacgaacgtattacaattctgtcatcatactactatgataccgaaatggagaattgtgaacatgagaggtcaatactgaagcggaggcttactgcatctgctattgaaatcgaaagacagcgaatgaaatgcttcccatga

Protein Analysis

231

Amino Acids

26.0

Weight (kDa)

6.96

Isoelectric Point (pI)

41.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 243
AccII CGCG 2 cut(s) 114, 534
AciI CCGC 6 cut(s) 108, 112, 282, 323, 410, 637
AclWI GGATC 2 cut(s) 99, 112
AcsI RAATTY 3 cut(s) 146, 344, 540
AcuI CTGAAG 1 cut(s) 653
AfaI GTAC 1 cut(s) 464
AfiI CCNNNNNNNGG 1 cut(s) 135
AflIII ACRYGT 1 cut(s) 361
AgsI TTSAA 3 cut(s) 146, 196, 662
AjiI CACGTC 1 cut(s) 274
AjnI CCWGG 1 cut(s) 160
AluBI AGCT 4 cut(s) 20, 80, 199, 511
AluI AGCT 4 cut(s) 20, 80, 199, 511
Alw26I GTCTC 2 cut(s) 90, 491
AlwI GGATC 2 cut(s) 99, 112
AoxI GGCC 2 cut(s) 258, 291
ApeKI GCWGC 1 cut(s) 307
ApoI RAATTY 3 cut(s) 146, 344, 540
ArsI GACNNNNNNTTYG 4 cut(s) 131, 163, 236, 268
Asp700I GAANNNNTTC 1 cut(s) 686
AspLEI GCGC 1 cut(s) 445
AspS9I GGNCC 3 cut(s) 202, 259, 292
AsuHPI GGTGA 2 cut(s) 353, 503
AvaII GGWCC 1 cut(s) 202
BamHI GGATCC 1 cut(s) 104
BbsI GAAGAC 2 cut(s) 335, 402
BbvI GCAGC 1 cut(s) 319
BccI CCATC 1 cut(s) 449
BcgI CGANNNNNNTGC 1 cut(s) 666
BciT130I CCWGG 1 cut(s) 162
BcoDI GTCTC 2 cut(s) 90, 491
BfaI CTAG 2 cut(s) 209, 486
BisI GCNGC 2 cut(s) 308, 411
BlsI GCNGC 2 cut(s) 309, 412
Bme1390I CCNGG 1 cut(s) 162
Bme18I GGWCC 1 cut(s) 202
BmgBI CACGTC 1 cut(s) 274
BmgT120I GGNCC 3 cut(s) 202, 259, 292
BmiI GGNNCC 3 cut(s) 8, 106, 294
BmrFI CCNGG 1 cut(s) 162
BmsI GCATC 3 cut(s) 417, 430, 659
BpiI GAAGAC 2 cut(s) 335, 402
BpuEI CTTGAG 1 cut(s) 533
BsaJI CCNNGG 2 cut(s) 160, 333
Bsc4I CCNNNNNNNGG 1 cut(s) 135
BseBI CCWGG 1 cut(s) 162
BseDI CCNNGG 2 cut(s) 160, 333
BseLI CCNNNNNNNGG 1 cut(s) 135
BseMII CTCAG 1 cut(s) 101
BseXI GCAGC 1 cut(s) 319
Bsh1236I CGCG 2 cut(s) 114, 534
BshFI GGCC 2 cut(s) 260, 293
BslFI GGGAC 2 cut(s) 152, 506
BslI CCNNNNNNNGG 1 cut(s) 135
BsmAI GTCTC 2 cut(s) 90, 491
BsmBI CGTCTC 1 cut(s) 90
BsmFI GGGAC 2 cut(s) 152, 506
BsmI GAATGC 1 cut(s) 372
BsnI GGCC 2 cut(s) 260, 293
Bsp143I GATC 3 cut(s) 24, 104, 287
Bsp68I TCGCGA 1 cut(s) 534
BspACI CCGC 6 cut(s) 108, 112, 282, 323, 410, 637
BspANI GGCC 2 cut(s) 260, 293
BspCNI CTCAG 1 cut(s) 100
BspFNI CGCG 2 cut(s) 114, 534
BspLI GGNNCC 3 cut(s) 8, 106, 294
BspPI GGATC 2 cut(s) 99, 112
BssECI CCNNGG 2 cut(s) 160, 333
BssMI GATC 3 cut(s) 24, 104, 287
Bst2UI CCWGG 1 cut(s) 162
Bst4CI ACNGT 2 cut(s) 181, 334
BstC8I GCNNGC 1 cut(s) 112
BstDEI CTNAG 1 cut(s) 87
BstDSI CCRYGG 1 cut(s) 333
BstFNI CGCG 2 cut(s) 114, 534
BstHHI GCGC 1 cut(s) 445
BstKTI GATC 3 cut(s) 27, 107, 290
BstMAI GTCTC 2 cut(s) 90, 491
BstMBI GATC 3 cut(s) 24, 104, 287
BstMWI GCNNNNNNNGC 1 cut(s) 266
BstNI CCWGG 1 cut(s) 162
BstNSI RCATGY 1 cut(s) 365
BstSCI CCNGG 1 cut(s) 160
BstUI CGCG 2 cut(s) 114, 534
BstV1I GCAGC 1 cut(s) 319
BstV2I GAAGAC 2 cut(s) 335, 402
BstX2I RGATCY 1 cut(s) 104
BstYI RGATCY 1 cut(s) 104
BsuRI GGCC 2 cut(s) 260, 293
BtgI CCRYGG 1 cut(s) 333
BtrI CACGTC 1 cut(s) 274
BtsIMutI CAGTG 1 cut(s) 355
BtuMI TCGCGA 1 cut(s) 534
Cac8I GCNNGC 1 cut(s) 112
CfoI GCGC 1 cut(s) 445
Cfr13I GGNCC 3 cut(s) 202, 259, 292
CseI GACGC 2 cut(s) 61, 103
Csp6I GTAC 1 cut(s) 463
CviAII CATG 3 cut(s) 362, 617, 693
CviJI RGCY 9 cut(s) 9, 20, 80, 199, 260, 293, 413, 511, 643
CviKI_1 RGCY 9 cut(s) 9, 20, 80, 199, 260, 293, 413, 511, 643
CviQI GTAC 1 cut(s) 463
DdeI CTNAG 1 cut(s) 87
DpnI GATC 3 cut(s) 26, 106, 289
DpnII GATC 3 cut(s) 24, 104, 287
EciI GGCGGA 1 cut(s) 97
Eco47I GGWCC 1 cut(s) 202
Eco57I CTGAAG 1 cut(s) 653
EcoRI GAATTC 1 cut(s) 344
EcoRII CCWGG 1 cut(s) 160
Esp3I CGTCTC 1 cut(s) 90
FaeI CATG 3 cut(s) 365, 620, 696
FaiI YATR 8 cut(s) 77, 219, 363, 393, 583, 591, 618, 694
FaqI GGGAC 2 cut(s) 152, 506
FatI CATG 3 cut(s) 361, 616, 692
FauI CCCGC 1 cut(s) 119
FblI GTMKAC 1 cut(s) 243
Fnu4HI GCNGC 2 cut(s) 308, 411
Fsp4HI GCNGC 2 cut(s) 308, 411
FspBI CTAG 2 cut(s) 209, 486
GlaI GCGC 1 cut(s) 444
GluI GCNGC 2 cut(s) 308, 411
HaeIII GGCC 2 cut(s) 260, 293
HgaI GACGC 2 cut(s) 61, 103
HhaI GCGC 1 cut(s) 445
Hin1II CATG 3 cut(s) 365, 620, 696
Hin6I GCGC 1 cut(s) 443
HinP1I GCGC 1 cut(s) 443
HincII GTYRAC 2 cut(s) 184, 244
HindII GTYRAC 2 cut(s) 184, 244
HindIII AAGCTT 1 cut(s) 509
HinfI GANTC 1 cut(s) 92
HphI GGTGA 2 cut(s) 353, 503
Hpy166II GTNNAC 3 cut(s) 184, 244, 614
Hpy188I TCNGA 5 cut(s) 24, 29, 104, 126, 368
Hpy188III TCNNGA 3 cut(s) 89, 452, 533
Hpy8I GTNNAC 3 cut(s) 184, 244, 614
Hpy99I CGWCG 3 cut(s) 119, 275, 534
HpyCH4III ACNGT 2 cut(s) 181, 334
HpyCH4IV ACGT 2 cut(s) 273, 562
HpyCH4V TGCA 1 cut(s) 650
HpyF10VI GCNNNNNNNGC 1 cut(s) 266
HpyF3I CTNAG 1 cut(s) 87
HpySE526I ACGT 2 cut(s) 273, 562
Hsp92II CATG 3 cut(s) 365, 620, 696
HspAI GCGC 1 cut(s) 443
Kzo9I GATC 3 cut(s) 24, 104, 287
LmnI GCTCC 2 cut(s) 6, 175
LpnPI CCDG 5 cut(s) 74, 82, 147, 174, 185
Lsp1109I GCAGC 1 cut(s) 319
LweI GCATC 3 cut(s) 417, 430, 659
MaeI CTAG 2 cut(s) 209, 486
MaeII ACGT 2 cut(s) 273, 562
MaeIII GTNAC 1 cut(s) 481
MalI GATC 3 cut(s) 26, 106, 289
MboI GATC 3 cut(s) 24, 104, 287
MboII GAAGA 5 cut(s) 148, 297, 340, 399, 407
MflI RGATCY 1 cut(s) 104
MluCI AATT 6 cut(s) 130, 146, 344, 540, 570, 607
MnlI CCTC 8 cut(s) 362, 427, 456, 482, 508, 529, 615, 633
MroXI GAANNNNTTC 1 cut(s) 686
MslI CAYNNNNRTG 1 cut(s) 453
MspA1I CMGCKG 1 cut(s) 282
MspR9I CCNGG 1 cut(s) 162
Mva1269I GAATGC 1 cut(s) 372
MvaI CCWGG 1 cut(s) 162
MvnI CGCG 2 cut(s) 114, 534
MwoI GCNNNNNNNGC 1 cut(s) 266
NdeII GATC 3 cut(s) 24, 104, 287
NlaIII CATG 3 cut(s) 365, 620, 696
NlaIV GGNNCC 3 cut(s) 8, 106, 294
NmuCI GTSAC 1 cut(s) 481
NruI TCGCGA 1 cut(s) 534
NspI RCATGY 1 cut(s) 365
PciI ACATGT 1 cut(s) 361
PctI GAATGC 1 cut(s) 372
PdmI GAANNNNTTC 1 cut(s) 686
PfeI GAWTC 1 cut(s) 92
PflFI GACNNNGTC 1 cut(s) 275
PkrI GCNGC 2 cut(s) 309, 412
PscI ACATGT 1 cut(s) 361
Psp6I CCWGG 1 cut(s) 160
PspGI CCWGG 1 cut(s) 160
PspN4I GGNNCC 3 cut(s) 8, 106, 294
PspPI GGNCC 3 cut(s) 202, 259, 292
PsuI RGATCY 1 cut(s) 104
PsyI GACNNNGTC 1 cut(s) 275
RruI TCGCGA 1 cut(s) 534
RsaI GTAC 1 cut(s) 464
RsaNI GTAC 1 cut(s) 463
RseI CAYNNNNRTG 1 cut(s) 453
SalI GTCGAC 1 cut(s) 242
SatI GCNGC 2 cut(s) 308, 411
Sau3AI GATC 3 cut(s) 24, 104, 287
Sau96I GGNCC 3 cut(s) 202, 259, 292
ScrFI CCNGG 1 cut(s) 162
SetI ASST 9 cut(s) 22, 82, 201, 214, 276, 493, 513, 565, 626
SfaNI GCATC 3 cut(s) 417, 430, 659
SinI GGWCC 1 cut(s) 202
SmiMI CAYNNNNRTG 1 cut(s) 453
SmlI CTYRAG 1 cut(s) 512
SmoI CTYRAG 1 cut(s) 512
Sse9I AATT 6 cut(s) 130, 146, 344, 540, 570, 607
SsiI CCGC 6 cut(s) 108, 112, 282, 323, 410, 637
SspI AATATT 1 cut(s) 471
SspMI CTAG 2 cut(s) 209, 486
StyD4I CCNGG 1 cut(s) 160
TaaI ACNGT 2 cut(s) 181, 334
TaiI ACGT 2 cut(s) 276, 565
TaqI TCGA 3 cut(s) 243, 425, 666
TasI AATT 6 cut(s) 130, 146, 344, 540, 570, 607
TauI GCSGC 1 cut(s) 413
TfiI GAWTC 1 cut(s) 92
TscAI CASTG 1 cut(s) 355
TseFI GTSAC 1 cut(s) 481
TseI GCWGC 1 cut(s) 307
Tsp45I GTSAC 1 cut(s) 481
TspDTI ATGAA 3 cut(s) 314, 408, 695
TspGWI ACGGA 1 cut(s) 194
TspRI CASTG 1 cut(s) 355
Tth111I GACNNNGTC 1 cut(s) 275
VpaK11BI GGWCC 1 cut(s) 202
XapI RAATTY 3 cut(s) 146, 344, 540
XceI RCATGY 1 cut(s) 365
XmiI GTMKAC 1 cut(s) 243
XmnI GAANNNNTTC 1 cut(s) 686
XspI CTAG 2 cut(s) 209, 486
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.