Rmu_sc0001685.1_g000043

Belongs to the ubiquitin-conjugating enzyme family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001685.1
Physical Location & Seq
Reverse (-)
225479 .. 227235
1757 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001685.1_g000043.1.cds

Sequence Viewer

Length: 459 bp
atgtcgactcctgcaaggaagagactgatgagggatttcaagaggttgcagcaggaccctcctgctggaataagcggtgctcctcaagacaataatataatgctttggaatgctgttatatttgggcccgatgacaccccgtgggatggaggtacgttcaagttgacacttcaattttccgaggattatccaaataagccaccaacagtgcgttttgtttctcgaatgtttcatccaaacatttatgcggatggaagcatttgtttggacatcctacagaatcagtggagccctatatatgatgtagcagctattcttacttccattcagtcattgctgtgtgatccaaacccgaactctccagcaaattcagaagctgcacggatgttcagtgagaacaagcgtgaatacaacagaagagtccgtgagattgttgagcagagttggactgctgattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

152

Amino Acids

17.33

Weight (kDa)

5.4

Isoelectric Point (pI)

73.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012745)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 5
AciI CCGC 2 cut(s) 75, 248
AclWI GGATC 1 cut(s) 338
AcsI RAATTY 1 cut(s) 367
AdeI CACNNNGTG 1 cut(s) 141
AfaI GTAC 1 cut(s) 154
AfiI CCNNNNNNNGG 2 cut(s) 65, 146
AgsI TTSAA 3 cut(s) 40, 160, 173
AluBI AGCT 2 cut(s) 311, 377
AluI AGCT 2 cut(s) 311, 377
Alw21I GWGCWC 1 cut(s) 82
Alw26I GTCTC 1 cut(s) 16
AlwI GGATC 1 cut(s) 338
AlwNI CAGNNNCTG 1 cut(s) 377
AoxI GGCC 1 cut(s) 125
ApaI GGGCCC 1 cut(s) 129
ApeKI GCWGC 3 cut(s) 49, 308, 377
ApoI RAATTY 1 cut(s) 367
AspS9I GGNCC 3 cut(s) 55, 125, 126
AvaII GGWCC 1 cut(s) 55
BaeGI GKGCMC 1 cut(s) 129
BanII GRGCYC 2 cut(s) 129, 293
Bbv12I GWGCWC 1 cut(s) 82
BbvI GCAGC 3 cut(s) 61, 320, 364
BccI CCATC 2 cut(s) 140, 245
BcoDI GTCTC 1 cut(s) 16
BfmI CTRYAG 1 cut(s) 275
BisI GCNGC 3 cut(s) 50, 309, 378
BlsI GCNGC 3 cut(s) 51, 310, 379
Bme18I GGWCC 1 cut(s) 55
BmgT120I GGNCC 3 cut(s) 55, 125, 126
BmiI GGNNCC 3 cut(s) 57, 127, 290
BpmI CTGGAG 1 cut(s) 345
BpuEI CTTGAG 1 cut(s) 69
BsaJI CCNNGG 2 cut(s) 140, 180
Bsc4I CCNNNNNNNGG 2 cut(s) 65, 146
Bse3DI GCAATG 1 cut(s) 332
BseDI CCNNGG 2 cut(s) 140, 180
BseGI GGATG 5 cut(s) 151, 232, 256, 270, 390
BseLI CCNNNNNNNGG 2 cut(s) 65, 146
BseMI GCAATG 1 cut(s) 332
BseRI GAGGAG 1 cut(s) 72
BseSI GKGCMC 1 cut(s) 129
BseXI GCAGC 3 cut(s) 61, 320, 364
BsgI GTGCAG 1 cut(s) 363
BshFI GGCC 1 cut(s) 127
BsiHKAI GWGCWC 1 cut(s) 82
BslI CCNNNNNNNGG 2 cut(s) 65, 146
BsmAI GTCTC 1 cut(s) 16
BsmI GAATGC 1 cut(s) 115
BsnI GGCC 1 cut(s) 127
Bsp120I GGGCCC 1 cut(s) 125
Bsp1286I GDGCHC 3 cut(s) 82, 129, 293
Bsp143I GATC 1 cut(s) 343
BspACI CCGC 2 cut(s) 75, 248
BspANI GGCC 1 cut(s) 127
BspLI GGNNCC 3 cut(s) 57, 127, 290
BspPI GGATC 1 cut(s) 338
BsrDI GCAATG 1 cut(s) 332
BssECI CCNNGG 2 cut(s) 140, 180
BssMI GATC 1 cut(s) 343
Bst4CI ACNGT 1 cut(s) 208
Bst6I CTCTTC 2 cut(s) 14, 412
BstDSI CCRYGG 1 cut(s) 140
BstF5I GGATG 5 cut(s) 151, 232, 256, 270, 390
BstKTI GATC 1 cut(s) 346
BstMAI GTCTC 1 cut(s) 16
BstMBI GATC 1 cut(s) 343
BstSFI CTRYAG 1 cut(s) 275
BstSLI GKGCMC 1 cut(s) 129
BstV1I GCAGC 3 cut(s) 61, 320, 364
BsuRI GGCC 1 cut(s) 127
BtgI CCRYGG 1 cut(s) 140
BtsCI GGATG 5 cut(s) 151, 232, 256, 270, 390
BtsIMutI CAGTG 3 cut(s) 213, 290, 397
CaiI CAGNNNCTG 1 cut(s) 377
Cfr13I GGNCC 3 cut(s) 55, 125, 126
Csp6I GTAC 1 cut(s) 153
CviJI RGCY 5 cut(s) 127, 199, 291, 311, 377
CviKI_1 RGCY 5 cut(s) 127, 199, 291, 311, 377
CviQI GTAC 1 cut(s) 153
DpnI GATC 1 cut(s) 345
DpnII GATC 1 cut(s) 343
DraIII CACNNNGTG 1 cut(s) 141
Eam1104I CTCTTC 2 cut(s) 14, 412
EarI CTCTTC 2 cut(s) 14, 412
Eco24I GRGCYC 2 cut(s) 129, 293
Eco47I GGWCC 1 cut(s) 55
EcoO109I RGGNCCY 1 cut(s) 55
EcoT38I GRGCYC 2 cut(s) 129, 293
FaiI YATR 6 cut(s) 98, 119, 246, 296, 298, 300
FblI GTMKAC 1 cut(s) 5
Fnu4HI GCNGC 3 cut(s) 50, 309, 378
FokI GGATG 5 cut(s) 158, 219, 257, 263, 397
FriOI GRGCYC 2 cut(s) 129, 293
Fsp4HI GCNGC 3 cut(s) 50, 309, 378
GluI GCNGC 3 cut(s) 50, 309, 378
GsuI CTGGAG 1 cut(s) 345
HaeIII GGCC 1 cut(s) 127
HincII GTYRAC 2 cut(s) 6, 165
HindII GTYRAC 2 cut(s) 6, 165
HinfI GANTC 3 cut(s) 7, 280, 420
Hpy166II GTNNAC 2 cut(s) 6, 165
Hpy188I TCNGA 2 cut(s) 181, 373
Hpy188III TCNNGA 3 cut(s) 40, 86, 222
Hpy8I GTNNAC 2 cut(s) 6, 165
HpyCH4III ACNGT 1 cut(s) 208
HpyCH4IV ACGT 1 cut(s) 155
HpyCH4V TGCA 3 cut(s) 14, 49, 380
HpySE526I ACGT 1 cut(s) 155
Kzo9I GATC 1 cut(s) 343
LmnI GCTCC 2 cut(s) 85, 288
LpnPI CCDG 5 cut(s) 24, 38, 51, 75, 375
Lsp1109I GCAGC 3 cut(s) 61, 320, 364
MaeII ACGT 1 cut(s) 155
MalI GATC 1 cut(s) 345
MboI GATC 1 cut(s) 343
MboII GAAGA 2 cut(s) 31, 429
MhlI GDGCHC 3 cut(s) 82, 129, 293
MluCI AATT 2 cut(s) 173, 367
MlyI GAGTC 1 cut(s) 429
MmeI TCCRAC 1 cut(s) 425
MnlI CCTC 6 cut(s) 24, 36, 69, 93, 143, 175
MslI CAYNNNNRTG 1 cut(s) 337
Mva1269I GAATGC 1 cut(s) 115
NdeII GATC 1 cut(s) 343
NlaIV GGNNCC 3 cut(s) 57, 127, 290
PctI GAATGC 1 cut(s) 115
PfeI GAWTC 1 cut(s) 280
PkrI GCNGC 3 cut(s) 51, 310, 379
PleI GAGTC 1 cut(s) 428
PpsI GAGTC 1 cut(s) 428
PpuMI RGGWCCY 1 cut(s) 55
Psp5II RGGWCCY 1 cut(s) 55
PspN4I GGNNCC 3 cut(s) 57, 127, 290
PspOMI GGGCCC 1 cut(s) 125
PspPI GGNCC 3 cut(s) 55, 125, 126
PspPPI RGGWCCY 1 cut(s) 55
PstNI CAGNNNCTG 1 cut(s) 377
RsaI GTAC 1 cut(s) 154
RsaNI GTAC 1 cut(s) 153
RseI CAYNNNNRTG 1 cut(s) 337
SalI GTCGAC 1 cut(s) 4
SatI GCNGC 3 cut(s) 50, 309, 378
Sau3AI GATC 1 cut(s) 343
Sau96I GGNCC 3 cut(s) 55, 125, 126
SchI GAGTC 1 cut(s) 429
SduI GDGCHC 3 cut(s) 82, 129, 293
SetI ASST 5 cut(s) 47, 154, 158, 313, 379
SfcI CTRYAG 1 cut(s) 275
SinI GGWCC 1 cut(s) 55
SmiMI CAYNNNNRTG 1 cut(s) 337
SmlI CTYRAG 1 cut(s) 84
SmoI CTYRAG 1 cut(s) 84
Sse9I AATT 2 cut(s) 173, 367
SsiI CCGC 2 cut(s) 75, 248
TaaI ACNGT 1 cut(s) 208
TaiI ACGT 1 cut(s) 158
TaqI TCGA 2 cut(s) 5, 223
TasI AATT 2 cut(s) 173, 367
TfiI GAWTC 1 cut(s) 280
TscAI CASTG 3 cut(s) 213, 290, 397
TseI GCWGC 3 cut(s) 49, 308, 377
TspDTI ATGAA 1 cut(s) 221
TspGWI ACGGA 2 cut(s) 397, 413
TspRI CASTG 3 cut(s) 213, 290, 397
VpaK11BI GGWCC 1 cut(s) 55
XapI RAATTY 1 cut(s) 367
XmiI GTMKAC 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.