Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001689.1

Orthogroup ID

OG0018063

Physical Location & Seq

Genomic Coordinates Reverse (-)

117478 .. 117768

Gene Structure 291 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001689.1_g000023.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 291 bp

atgttgattttgcaggaagaagtatacaaagataataggtggaagttgatcgaggaggatctgaaaaatgtgattgatgcagagtcactagagactacacttgaattgattgatgacatccaacgattaggtttgggacaccgatttgaggccagtataactgaagcccttgataaagttttgaagaatcttgaccaaataacagacgaggatactccaagtctgtacctcactgctctcagcttcagactccttagacaacatgggtttcaagtctcccaaggtaagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00900 ko01110 map00900 map01110

Pfam Domains

Protein Families

Terpene_synth Terpene_synth_C

Protein Analysis

96

Amino Acids

11.13

Weight (kDa)

4.61

Isoelectric Point (pI)

41.17

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018063)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g44541
rosa_multiflora	Rmu_sc0001689.1_g000023 Rmu_sc0003707.1_g000004 Rmu_sc0005946.1_g000019 Rmu_sc0035512.1_g000001 Rmu_sc0041917.1_g000001
rosa_roxburghii	Rroxscaffold_2G00089610 Rroxscaffold_2G00089700
rosa_samantha	Rh2AG549200 Rh2CG533500 Rh6CG047100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	24
AclWI	GGATC	1 cut(s)	66
AcuI	CTGAAG	2 cut(s)	183, 229
AfaI	GTAC	1 cut(s)	227
AfiI	CCNNNNNNNGG	1 cut(s)	148
AgsI	TTSAA	3 cut(s)	104, 184, 272
AluBI	AGCT	1 cut(s)	243
AluI	AGCT	1 cut(s)	243
Alw26I	GTCTC	2 cut(s)	86, 280
AlwI	GGATC	1 cut(s)	66
AoxI	GGCC	1 cut(s)	150
BciVI	GTATCC	1 cut(s)	205
BcoDI	GTCTC	2 cut(s)	86, 280
BfaI	CTAG	1 cut(s)	89
BfuI	GTATCC	1 cut(s)	205
BmsI	GCATC	1 cut(s)	67
BsaJI	CCNNGG	1 cut(s)	280
Bsc4I	CCNNNNNNNGG	1 cut(s)	148
Bse1I	ACTGG	1 cut(s)	153
BseDI	CCNNGG	1 cut(s)	280
BseGI	GGATG	1 cut(s)	117
BseLI	CCNNNNNNNGG	1 cut(s)	148
BseMII	CTCAG	1 cut(s)	253
BseNI	ACTGG	1 cut(s)	153
BseRI	GAGGAG	1 cut(s)	68
BshFI	GGCC	1 cut(s)	152
BslFI	GGGAC	1 cut(s)	150
BslI	CCNNNNNNNGG	1 cut(s)	148
BsmAI	GTCTC	2 cut(s)	86, 280
BsmFI	GGGAC	1 cut(s)	150
BsnI	GGCC	1 cut(s)	152
Bsp143I	GATC	2 cut(s)	48, 58
BspANI	GGCC	1 cut(s)	152
BspCNI	CTCAG	1 cut(s)	252
BspPI	GGATC	1 cut(s)	66
BsrI	ACTGG	1 cut(s)	153
BssECI	CCNNGG	1 cut(s)	280
BssMI	GATC	2 cut(s)	48, 58
BssNAI	GTATAC	1 cut(s)	25
BssT1I	CCWWGG	1 cut(s)	280
Bst1107I	GTATAC	1 cut(s)	25
BstDEI	CTNAG	2 cut(s)	239, 254
BstF5I	GGATG	1 cut(s)	117
BstKTI	GATC	2 cut(s)	51, 61
BstMAI	GTCTC	2 cut(s)	86, 280
BstMBI	GATC	2 cut(s)	48, 58
BstX2I	RGATCY	1 cut(s)	58
BstYI	RGATCY	1 cut(s)	58
BstZ17I	GTATAC	1 cut(s)	25
BsuI	GTATCC	1 cut(s)	205
BsuRI	GGCC	1 cut(s)	152
BtsCI	GGATG	1 cut(s)	117
BtsI	GCAGTG	1 cut(s)	231
BtsIMutI	CAGTG	1 cut(s)	231
Csp6I	GTAC	1 cut(s)	226
CviAII	CATG	1 cut(s)	263
CviJI	RGCY	3 cut(s)	152, 167, 243
CviKI_1	RGCY	3 cut(s)	152, 167, 243
CviQI	GTAC	1 cut(s)	226
DdeI	CTNAG	2 cut(s)	239, 254
DpnI	GATC	2 cut(s)	50, 60
DpnII	GATC	2 cut(s)	48, 58
Eco130I	CCWWGG	1 cut(s)	280
Eco57I	CTGAAG	2 cut(s)	183, 229
EcoT14I	CCWWGG	1 cut(s)	280
ErhI	CCWWGG	1 cut(s)	280
FaeI	CATG	1 cut(s)	266
FaiI	YATR	3 cut(s)	25, 158, 264
FaqI	GGGAC	1 cut(s)	150
FatI	CATG	1 cut(s)	262
FblI	GTMKAC	1 cut(s)	24
FokI	GGATG	1 cut(s)	104
FspBI	CTAG	1 cut(s)	89
HaeIII	GGCC	1 cut(s)	152
Hin1II	CATG	1 cut(s)	266
HinfI	GANTC	3 cut(s)	83, 187, 249
Hpy166II	GTNNAC	1 cut(s)	25
Hpy188I	TCNGA	2 cut(s)	63, 248
Hpy188III	TCNNGA	1 cut(s)	191
Hpy8I	GTNNAC	1 cut(s)	25
HpyCH4V	TGCA	2 cut(s)	13, 80
HpyF3I	CTNAG	2 cut(s)	239, 254
Hsp92II	CATG	1 cut(s)	266
Kzo9I	GATC	2 cut(s)	48, 58
LpnPI	CCDG	1 cut(s)	166
LweI	GCATC	1 cut(s)	67
MaeI	CTAG	1 cut(s)	89
MaeIII	GTNAC	1 cut(s)	84
MalI	GATC	2 cut(s)	50, 60
MboI	GATC	2 cut(s)	48, 58
MboII	GAAGA	2 cut(s)	29, 196
MflI	RGATCY	1 cut(s)	58
MluCI	AATT	1 cut(s)	104
MlyI	GAGTC	2 cut(s)	92, 243
MmeI	TCCRAC	1 cut(s)	145
MnlI	CCTC	5 cut(s)	46, 49, 142, 202, 239
NdeII	GATC	2 cut(s)	48, 58
NlaIII	CATG	1 cut(s)	266
NmuCI	GTSAC	1 cut(s)	84
PfeI	GAWTC	1 cut(s)	187
PleI	GAGTC	2 cut(s)	91, 243
PpsI	GAGTC	2 cut(s)	91, 243
PsuI	RGATCY	1 cut(s)	58
RsaI	GTAC	1 cut(s)	227
RsaNI	GTAC	1 cut(s)	226
Sau3AI	GATC	2 cut(s)	48, 58
SchI	GAGTC	2 cut(s)	92, 243
SetI	ASST	5 cut(s)	41, 133, 231, 245, 286
SfaNI	GCATC	1 cut(s)	67
Sse9I	AATT	1 cut(s)	104
SspMI	CTAG	1 cut(s)	89
StyI	CCWWGG	1 cut(s)	280
TaqI	TCGA	1 cut(s)	51
TasI	AATT	1 cut(s)	104
TfiI	GAWTC	1 cut(s)	187
TscAI	CASTG	1 cut(s)	238
TseFI	GTSAC	1 cut(s)	84
Tsp45I	GTSAC	1 cut(s)	84
TspRI	CASTG	1 cut(s)	238
XmiI	GTMKAC	1 cut(s)	24
XspI	CTAG	1 cut(s)	89

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.