Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001791.1

Orthogroup ID

OG0002660

Physical Location & Seq

Genomic Coordinates Forward (+)

91901 .. 94397

Gene Structure 2497 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001791.1_g000015.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1251 bp

atgtctcccaacacagtggatgagccgtctagaacccagaaagagaaagaggaattagaccatgcaattgcgctctctctggctgaagattcaaagagacacagaggatatagatggcaggacaaagataacgagctagctaggtcacttcaggatataaatccaccaatatatcctccacatgcccctccagttcctcaacataatccgtatgcagttcctcaacataatacgtatggaactagaatatgtggtggttgtcagcaagatatacgttacgggagggatccttatcataagtcctgttttaaggagctggcccatccaaaatgtgaagtttgtcatcaatttattccaacgaatcaagctggtttgatcgagtatagatgccatccattttggtcacaaaaatactgtccatcacatgaacatgataacacagctcgttgctgtagttgtgaacgcttagagtcttgggatgcaagatatatttcagtgggagatggacggagtctatgctttgaatgtatggaatcagctatcatggatactggtgattgtcagccattgtatcatgccatcagagattattatgaaggaatgaatatgaaattagatcagcaaattcccatgcttctggttgaaagacaagcacttaacgaagctattgtcggggagaagaatggcctccatcacatgcccgagacaaggggtttatgcctttctgaagagcagacagtcaccagtatactcaaaaggccaagaattggagggcatcaacttatcggaatgagaacccaacctcaaaagttgactcgaagatgtgaagttactgccattcttgttctctatagccttccaagattactaacaggtgctattcttgctcatgagttgatgcacggctggttacgtctcaaaggctaccgtaaccttaatcctgaagtagaggaaggtatctgtcaagtgctttcatacatgtggcttgaaacagaagtaatgccaggattcaaaaacatgccatccacgtctacatgtgcagcttcttcttccacttcctcatcctcatcgaaaaagggtggaaagtcgaatgttgaacagaagcttggtgaatttttcatgcatcaaattgcgaatgattcttccccagcatatggtggagggtttagagcagctaatgcagctgtcaataagtatggtttacgtcgtactctggatcacattcgactcactggaaatttcccattgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0005515 GO:0007275 GO:0008150 GO:0009888 GO:0010087 GO:0010088 GO:0022622 GO:0032182 GO:0032501 GO:0032502 GO:0043130 GO:0048364 GO:0048731 GO:0048856 GO:0099402

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DA1-like LIM

Protein Analysis

416

Amino Acids

47.12

Weight (kDa)

7.26

Isoelectric Point (pI)

55.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002660)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G39830 AT2G39830 AT2G39830 AT2G39830
fragaria_vesca	FvH4_7g23550 FvH4_7g23550 FvH4_7g23550 FvH4_7g23550 FvH4_7g23550 FvH4_7g23550 FvH4_7g23550
malus_domestica	MD01G1141300.v1.1 MD07G1205300.v1.1 MD07G1205400.v1.1
prunus_persica	Prupe.2G241500_v2.0.a1 Prupe.2G241500_v2.0.a1 Prupe.2G241500_v2.0.a1 Prupe.2G241500_v2.0.a1 Prupe.2G241500_v2.0.a1 Prupe.2G241500_v2.0.a1
pyrus_communis	pycom01g16160 pycom07g19190 pycom07g19200
rosa_chinensis	RchiOBHm_Chr1g0368711
rosa_laevigata	RLG00000027195
rosa_multiflora	Rmu_sc0001791.1_g000014 Rmu_sc0001791.1_g000015
rosa_roxburghii	Rroxscaffold_4G00288340
rosa_rugosa	Rorug01G0343900 Rorug01G0343900 Rorug01G0344000 Rorug01G0344000 Rorug01G0344100 Rorug01G0344100 Rorug01G0344100 Rorug01G0344100
rosa_samantha	Rh1AG351400 Rh1BG315100 Rh1CG329700 Rh1DG346600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	2 cut(s)	767, 1154
AccI	GTMKAC	2 cut(s)	748, 1031
AclWI	GGATC	3 cut(s)	281, 294, 1224
AcsI	RAATTY	3 cut(s)	624, 1112, 1237
AcuI	CTGAAG	4 cut(s)	105, 134, 747, 963
AfaI	GTAC	1 cut(s)	1210
AfiI	CCNNNNNNNGG	3 cut(s)	708, 767, 1154
AflIII	ACRYGT	2 cut(s)	978, 1034
AgsI	TTSAA	6 cut(s)	93, 524, 644, 989, 1012, 1097
AjiI	CACGTC	1 cut(s)	1029
AjnI	CCWGG	1 cut(s)	1003
AjuI	GAANNNNNNNTTGG	2 cut(s)	1089, 1121
Alw26I	GTCTC	4 cut(s)	9, 91, 698, 920
AlwI	GGATC	3 cut(s)	281, 294, 1224
Ama87I	CYCGRG	1 cut(s)	701
AoxI	GGCC	3 cut(s)	318, 685, 758
ApeKI	GCWGC	3 cut(s)	1040, 1172, 1181
ApoI	RAATTY	3 cut(s)	624, 1112, 1237
ArsI	GACNNNNNNTTYG	4 cut(s)	400, 432, 654, 686
AspLEI	GCGC	1 cut(s)	73
AspS9I	GGNCC	1 cut(s)	319
AsuHPI	GGTGA	3 cut(s)	566, 733, 1121
AsuNHI	GCTAGC	1 cut(s)	136
AvaI	CYCGRG	1 cut(s)	701
BamHI	GGATCC	1 cut(s)	286
BbvI	GCAGC	3 cut(s)	1052, 1184, 1193
BccI	CCATC	8 cut(s)	108, 330, 399, 427, 497, 587, 699, 1030
BceAI	ACGGC	2 cut(s)	10, 919
BciT130I	CCWGG	1 cut(s)	1005
BciVI	GTATCC	1 cut(s)	541
BcoDI	GTCTC	4 cut(s)	9, 91, 698, 920
BfaI	CTAG	4 cut(s)	30, 137, 141, 243
BfmI	CTRYAG	2 cut(s)	451, 850
BfuI	GTATCC	1 cut(s)	541
BisI	GCNGC	3 cut(s)	1041, 1173, 1182
BlsI	GCNGC	3 cut(s)	1042, 1174, 1183
Bme1390I	CCNGG	1 cut(s)	1005
BmeT110I	CYCGRG	1 cut(s)	701
BmgBI	CACGTC	1 cut(s)	1029
BmgT120I	GGNCC	1 cut(s)	319
BmiI	GGNNCC	1 cut(s)	288
BmrFI	CCNGG	1 cut(s)	1005
BmsI	GCATC	5 cut(s)	377, 469, 784, 888, 1132
BmtI	GCTAGC	1 cut(s)	140
BpmI	CTGGAG	1 cut(s)	174
BsaAI	YACGTR	1 cut(s)	234
BsaBI	GATNNNNATC	2 cut(s)	159, 291
Bsc4I	CCNNNNNNNGG	3 cut(s)	708, 767, 1154
Bse1I	ACTGG	4 cut(s)	191, 556, 744, 1237
Bse8I	GATNNNNATC	2 cut(s)	159, 291
BseBI	CCWGG	1 cut(s)	1005
BseGI	GGATG	6 cut(s)	25, 322, 391, 484, 1022, 1061
BseJI	GATNNNNATC	2 cut(s)	159, 291
BseLI	CCNNNNNNNGG	3 cut(s)	708, 767, 1154
BseNI	ACTGG	4 cut(s)	191, 556, 744, 1237
BseXI	GCAGC	3 cut(s)	1052, 1184, 1193
BseYI	CCCAGC	1 cut(s)	1147
BsgI	GTGCAG	1 cut(s)	1059
BshFI	GGCC	3 cut(s)	320, 687, 760
BsiHKCI	CYCGRG	1 cut(s)	701
BslI	CCNNNNNNNGG	3 cut(s)	708, 767, 1154
BsmAI	GTCTC	4 cut(s)	9, 91, 698, 920
BsmBI	CGTCTC	1 cut(s)	920
BsnI	GGCC	3 cut(s)	320, 687, 760
BsoBI	CYCGRG	1 cut(s)	701
Bsp143I	GATC	4 cut(s)	286, 375, 616, 1216
BspANI	GGCC	3 cut(s)	320, 687, 760
BspHI	TCATGA	1 cut(s)	889
BspLI	GGNNCC	1 cut(s)	288
BspOI	GCTAGC	1 cut(s)	140
BspPI	GGATC	3 cut(s)	281, 294, 1224
BspQI	GCTCTTC	1 cut(s)	723
BsrI	ACTGG	4 cut(s)	191, 556, 744, 1237
BssMI	GATC	4 cut(s)	286, 375, 616, 1216
BssNAI	GTATAC	1 cut(s)	749
Bst1107I	GTATAC	1 cut(s)	749
Bst2UI	CCWGG	1 cut(s)	1005
Bst4CI	ACNGT	4 cut(s)	16, 416, 739, 929
Bst6I	CTCTTC	1 cut(s)	723
BstAPI	GCANNNNNTGC	1 cut(s)	1178
BstBAI	YACGTR	1 cut(s)	234
BstC8I	GCNNGC	2 cut(s)	138, 318
BstDEI	CTNAG	1 cut(s)	466
BstF5I	GGATG	6 cut(s)	25, 322, 391, 484, 1022, 1061
BstHHI	GCGC	1 cut(s)	73
BstKTI	GATC	4 cut(s)	289, 378, 619, 1219
BstMAI	GTCTC	4 cut(s)	9, 91, 698, 920
BstMBI	GATC	4 cut(s)	286, 375, 616, 1216
BstMWI	GCNNNNNNNGC	3 cut(s)	884, 1178, 1181
BstNI	CCWGG	1 cut(s)	1005
BstNSI	RCATGY	5 cut(s)	185, 700, 982, 1021, 1038
BstSCI	CCNGG	1 cut(s)	1003
BstSFI	CTRYAG	2 cut(s)	451, 850
BstSNI	TACGTA	1 cut(s)	234
BstV1I	GCAGC	3 cut(s)	1052, 1184, 1193
BstX2I	RGATCY	1 cut(s)	286
BstXI	CCANNNNNNTGG	2 cut(s)	16, 637
BstYI	RGATCY	1 cut(s)	286
BstZ17I	GTATAC	1 cut(s)	749
BsuI	GTATCC	1 cut(s)	541
BsuRI	GGCC	3 cut(s)	320, 687, 760
BtrI	CACGTC	1 cut(s)	1029
BtsCI	GGATG	6 cut(s)	25, 322, 391, 484, 1022, 1061
BtsIMutI	CAGTG	3 cut(s)	21, 501, 1230
Cac8I	GCNNGC	2 cut(s)	138, 318
CciI	TCATGA	1 cut(s)	889
CfoI	GCGC	1 cut(s)	73
Cfr13I	GGNCC	1 cut(s)	319
Csp6I	GTAC	1 cut(s)	1209
CviQI	GTAC	1 cut(s)	1209
DdeI	CTNAG	1 cut(s)	466
DpnI	GATC	4 cut(s)	288, 377, 618, 1218
DpnII	GATC	4 cut(s)	286, 375, 616, 1216
Eam1104I	CTCTTC	1 cut(s)	723
EarI	CTCTTC	1 cut(s)	723
Eco105I	TACGTA	1 cut(s)	234
Eco57I	CTGAAG	4 cut(s)	105, 134, 747, 963
Eco88I	CYCGRG	1 cut(s)	701
EcoRII	CCWGG	1 cut(s)	1003
EcoT22I	ATGCAT	1 cut(s)	1125
Esp3I	CGTCTC	1 cut(s)	920
FauNDI	CATATG	1 cut(s)	1153
FblI	GTMKAC	2 cut(s)	748, 1031
Fnu4HI	GCNGC	3 cut(s)	1041, 1173, 1182
FokI	GGATG	6 cut(s)	32, 309, 378, 491, 1009, 1048
Fsp4HI	GCNGC	3 cut(s)	1041, 1173, 1182
FspBI	CTAG	4 cut(s)	30, 137, 141, 243
GlaI	GCGC	1 cut(s)	72
GluI	GCNGC	3 cut(s)	1041, 1173, 1182
GsaI	CCCAGC	1 cut(s)	1151
GsuI	CTGGAG	1 cut(s)	174
HaeIII	GGCC	3 cut(s)	320, 687, 760
HhaI	GCGC	1 cut(s)	73
Hin6I	GCGC	1 cut(s)	71
HinP1I	GCGC	1 cut(s)	71
HincII	GTYRAC	1 cut(s)	813
HindII	GTYRAC	1 cut(s)	813
HindIII	AAGCTT	1 cut(s)	1103
HinfI	GANTC	9 cut(s)	89, 361, 470, 511, 533, 814, 1008, 1139, 1227
HphI	GGTGA	3 cut(s)	566, 733, 1121
Hpy166II	GTNNAC	5 cut(s)	461, 749, 813, 1032, 1202
Hpy188I	TCNGA	3 cut(s)	584, 727, 788
Hpy188III	TCNNGA	5 cut(s)	30, 152, 890, 941, 1214
Hpy8I	GTNNAC	5 cut(s)	461, 749, 813, 1032, 1202
Hpy99I	CGWCG	1 cut(s)	1209
HpyAV	CCTTC	3 cut(s)	590, 866, 947
HpyCH4III	ACNGT	4 cut(s)	16, 416, 739, 929
HpyCH4IV	ACGT	5 cut(s)	233, 274, 913, 1028, 1204
HpyCH4V	TGCA	7 cut(s)	65, 215, 482, 901, 1040, 1123, 1181
HpyF10VI	GCNNNNNNNGC	3 cut(s)	884, 1178, 1181
HpyF3I	CTNAG	1 cut(s)	466
HpySE526I	ACGT	5 cut(s)	233, 274, 913, 1028, 1204
HspAI	GCGC	1 cut(s)	71
Kzo9I	GATC	4 cut(s)	286, 375, 616, 1216
LguI	GCTCTTC	1 cut(s)	723
LmnI	GCTCC	1 cut(s)	313
Lsp1109I	GCAGC	3 cut(s)	1052, 1184, 1193
LweI	GCATC	5 cut(s)	377, 469, 784, 888, 1132
MaeI	CTAG	4 cut(s)	30, 137, 141, 243
MaeII	ACGT	5 cut(s)	233, 274, 913, 1028, 1204
MaeIII	GTNAC	7 cut(s)	144, 275, 402, 739, 829, 909, 929
MalI	GATC	4 cut(s)	288, 377, 618, 1218
MboI	GATC	4 cut(s)	286, 375, 616, 1216
MboII	GAAGA	7 cut(s)	98, 691, 740, 831, 1038, 1041, 1134
MfeI	CAATTG	1 cut(s)	66
MflI	RGATCY	1 cut(s)	286
MluCI	AATT	9 cut(s)	53, 66, 347, 611, 624, 765, 1112, 1128, 1237
MlyI	GAGTC	4 cut(s)	479, 520, 808, 1221
MmeI	TCCRAC	1 cut(s)	380
Mph1103I	ATGCAT	1 cut(s)	1125
MseI	TTAA	3 cut(s)	309, 657, 936
MslI	CAYNNNNRTG	2 cut(s)	429, 979
MspA1I	CMGCKG	1 cut(s)	1184
MspR9I	CCNGG	1 cut(s)	1005
MunI	CAATTG	1 cut(s)	66
MvaI	CCWGG	1 cut(s)	1005
MwoI	GCNNNNNNNGC	3 cut(s)	884, 1178, 1181
NdeI	CATATG	1 cut(s)	1153
NdeII	GATC	4 cut(s)	286, 375, 616, 1216
NheI	GCTAGC	1 cut(s)	136
NlaIV	GGNNCC	1 cut(s)	288
NmuCI	GTSAC	3 cut(s)	144, 402, 739
NsiI	ATGCAT	1 cut(s)	1125
NspI	RCATGY	5 cut(s)	185, 700, 982, 1021, 1038
PagI	TCATGA	1 cut(s)	889
PciI	ACATGT	2 cut(s)	978, 1034
PciSI	GCTCTTC	1 cut(s)	723
PfeI	GAWTC	5 cut(s)	89, 361, 533, 1008, 1139
PflFI	GACNNNGTC	1 cut(s)	510
PflMI	CCANNNNNTGG	2 cut(s)	767, 1154
PkrI	GCNGC	3 cut(s)	1042, 1174, 1183
PleI	GAGTC	4 cut(s)	478, 519, 808, 1221
PpsI	GAGTC	4 cut(s)	478, 519, 808, 1221
Ppu21I	YACGTR	1 cut(s)	234
PscI	ACATGT	2 cut(s)	978, 1034
Psp6I	CCWGG	1 cut(s)	1003
PspFI	CCCAGC	1 cut(s)	1147
PspGI	CCWGG	1 cut(s)	1003
PspN4I	GGNNCC	1 cut(s)	288
PspPI	GGNCC	1 cut(s)	319
PsuI	RGATCY	1 cut(s)	286
PsyI	GACNNNGTC	1 cut(s)	510
PvuII	CAGCTG	1 cut(s)	1184
RsaI	GTAC	1 cut(s)	1210
RsaNI	GTAC	1 cut(s)	1209
RseI	CAYNNNNRTG	2 cut(s)	429, 979
SapI	GCTCTTC	1 cut(s)	723
SaqAI	TTAA	3 cut(s)	309, 657, 936
SatI	GCNGC	3 cut(s)	1041, 1173, 1182
Sau3AI	GATC	4 cut(s)	286, 375, 616, 1216
Sau96I	GGNCC	1 cut(s)	319
SchI	GAGTC	4 cut(s)	479, 520, 808, 1221
ScrFI	CCNGG	1 cut(s)	1005
SfaNI	GCATC	5 cut(s)	377, 469, 784, 888, 1132
SfcI	CTRYAG	2 cut(s)	451, 850
SmiMI	CAYNNNNRTG	2 cut(s)	429, 979
SnaBI	TACGTA	1 cut(s)	234
Sse9I	AATT	9 cut(s)	53, 66, 347, 611, 624, 765, 1112, 1128, 1237
SspMI	CTAG	4 cut(s)	30, 137, 141, 243
StyD4I	CCNGG	1 cut(s)	1003
TaaI	ACNGT	4 cut(s)	16, 416, 739, 929
TaiI	ACGT	5 cut(s)	236, 277, 916, 1031, 1207
TaqI	TCGA	5 cut(s)	378, 817, 1070, 1088, 1225
TasI	AATT	9 cut(s)	53, 66, 347, 611, 624, 765, 1112, 1128, 1237
TfiI	GAWTC	5 cut(s)	89, 361, 533, 1008, 1139
Tru1I	TTAA	3 cut(s)	309, 657, 936
Tru9I	TTAA	3 cut(s)	309, 657, 936
TscAI	CASTG	3 cut(s)	21, 501, 1237
TseFI	GTSAC	3 cut(s)	144, 402, 739
TseI	GCWGC	3 cut(s)	1040, 1172, 1181
Tsp45I	GTSAC	3 cut(s)	144, 402, 739
TspDTI	ATGAA	6 cut(s)	441, 609, 617, 623, 963, 1108
TspGWI	ACGGA	2 cut(s)	198, 523
TspRI	CASTG	3 cut(s)	21, 501, 1237
Tth111I	GACNNNGTC	1 cut(s)	510
Van91I	CCANNNNNTGG	2 cut(s)	767, 1154
XapI	RAATTY	3 cut(s)	624, 1112, 1237
XbaI	TCTAGA	1 cut(s)	29
XceI	RCATGY	5 cut(s)	185, 700, 982, 1021, 1038
XmiI	GTMKAC	2 cut(s)	748, 1031
XspI	CTAG	4 cut(s)	30, 137, 141, 243
Zsp2I	ATGCAT	1 cut(s)	1125

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.