Rmu_sc0001851.1_g000029

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001851.1
Physical Location & Seq
Reverse (-)
159230 .. 160498
1269 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001851.1_g000029.1.cds

Sequence Viewer

Length: 465 bp
atgtcttgcttgatgctgaggcttccaccagccaaaaggcttcacttccaaactagacagcaagctcacaaacgcaaagtcattaacaaatccagaaatgaagtcaagtttcttcagctacgcagcctacgcttgctgcacagagcaggcttttcgctgcgcttttgccagaattgtcgtagcctgcttcaaaacaggcatgcgcatgtttatgttgacaagctctttaaagagcctgctgtctctgagctagttgctgatcattgtcaacagcagaaaactcccctagccaagtttgtgatcaagcttattgttgattgctctttaccggaagcaagcaagcaatttcaatctgcagttaccgagaatagcgggtctagccgcccaatttggaggtcagctgcggcgactctgccacctttggtggaggcattttccggtggcttccggccactctcgggatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

154

Amino Acids

17.49

Weight (kDa)

10.6

Isoelectric Point (pI)

61.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014610)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G20500
fragaria_vesca FvH4_2g21490
malus_domestica MD05G1197200.v1.1
prunus_persica Prupe.8G223700_v2.0.a1
pyrus_communis pycom05g18430 pycom10g15920
rosa_chinensis RchiOBHm_Chr6g0288121
rosa_laevigata RLG00000012436
rosa_multiflora Rmu_sc0001851.1_g000029 Rmu_sc0010766.1_g000005
rosa_roxburghii Rroxscaffold_7G00180480
rosa_rugosa Rorug06G0194400.1
rosa_samantha Rh6AG304600 Rh6BG310600 Rh6CG318700 Rh6DG303600
rosa_wichuraiana Rw6G026370

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 204
AciI CCGC 3 cut(s) 372, 382, 404
AcoI YGGCCR 1 cut(s) 449
AcuI CTGAAG 1 cut(s) 98
AfiI CCNNNNNNNGG 1 cut(s) 458
AgsI TTSAA 2 cut(s) 191, 350
AluBI AGCT 6 cut(s) 65, 118, 223, 250, 307, 401
AluI AGCT 6 cut(s) 65, 118, 223, 250, 307, 401
Alw26I GTCTC 1 cut(s) 247
Ama87I CYCGRG 1 cut(s) 457
AoxI GGCC 1 cut(s) 449
ApeKI GCWGC 4 cut(s) 123, 136, 157, 401
ArsI GACNNNNNNTTYG 2 cut(s) 63, 95
AspLEI GCGC 2 cut(s) 162, 205
AvaI CYCGRG 1 cut(s) 457
BbvCI CCTCAGC 1 cut(s) 17
BbvI GCAGC 4 cut(s) 123, 135, 144, 388
BcgI CGANNNNNNTGC 2 cut(s) 135, 169
BclI TGATCA 2 cut(s) 259, 300
BcoDI GTCTC 1 cut(s) 247
BfaI CTAG 4 cut(s) 54, 251, 287, 378
BfmI CTRYAG 1 cut(s) 354
BisI GCNGC 6 cut(s) 124, 137, 158, 382, 402, 405
BlsI GCNGC 6 cut(s) 125, 138, 159, 383, 403, 406
BmeT110I CYCGRG 1 cut(s) 457
BmsI GCATC 1 cut(s) 3
Bpu10I CCTNAGC 1 cut(s) 17
BsaWI WCCGGW 2 cut(s) 328, 437
Bsc4I CCNNNNNNNGG 1 cut(s) 458
BseLI CCNNNNNNNGG 1 cut(s) 458
BseMII CTCAG 2 cut(s) 8, 237
BseXI GCAGC 4 cut(s) 123, 135, 144, 388
BsgI GTGCAG 1 cut(s) 122
BshFI GGCC 1 cut(s) 451
BsiHKCI CYCGRG 1 cut(s) 457
BsiSI CCGG 3 cut(s) 329, 438, 448
BslI CCNNNNNNNGG 1 cut(s) 458
BsmAI GTCTC 1 cut(s) 247
BsnI GGCC 1 cut(s) 451
BsoBI CYCGRG 1 cut(s) 457
Bsp143I GATC 2 cut(s) 259, 300
BspACI CCGC 3 cut(s) 372, 382, 404
BspANI GGCC 1 cut(s) 451
BspCNI CTCAG 2 cut(s) 9, 238
BspMAI CTGCAG 1 cut(s) 358
BssMI GATC 2 cut(s) 259, 300
BstC8I GCNNGC 8 cut(s) 63, 134, 148, 185, 201, 237, 337, 341
BstDEI CTNAG 2 cut(s) 17, 246
BstHHI GCGC 2 cut(s) 162, 205
BstKTI GATC 2 cut(s) 262, 303
BstMAI GTCTC 1 cut(s) 247
BstMBI GATC 2 cut(s) 259, 300
BstMWI GCNNNNNNNGC 2 cut(s) 129, 378
BstNSI RCATGY 2 cut(s) 203, 209
BstSFI CTRYAG 1 cut(s) 354
BstV1I GCAGC 4 cut(s) 123, 135, 144, 388
BsuRI GGCC 1 cut(s) 451
Cac8I GCNNGC 8 cut(s) 63, 134, 148, 185, 201, 237, 337, 341
CfoI GCGC 2 cut(s) 162, 205
CviAII CATG 2 cut(s) 200, 206
DdeI CTNAG 2 cut(s) 17, 246
DpnI GATC 2 cut(s) 261, 302
DpnII GATC 2 cut(s) 259, 300
DraI TTTAAA 1 cut(s) 229
EaeI YGGCCR 1 cut(s) 449
Eco57I CTGAAG 1 cut(s) 98
Eco88I CYCGRG 1 cut(s) 457
FaeI CATG 2 cut(s) 203, 209
FaiI YATR 3 cut(s) 201, 207, 213
FatI CATG 2 cut(s) 199, 205
FauI CCCGC 1 cut(s) 365
FbaI TGATCA 2 cut(s) 259, 300
Fnu4HI GCNGC 6 cut(s) 124, 137, 158, 382, 402, 405
Fsp4HI GCNGC 6 cut(s) 124, 137, 158, 382, 402, 405
FspAI RTGCGCAY 1 cut(s) 204
FspBI CTAG 4 cut(s) 54, 251, 287, 378
FspI TGCGCA 1 cut(s) 204
GlaI GCGC 2 cut(s) 161, 204
GluI GCNGC 6 cut(s) 124, 137, 158, 382, 402, 405
HaeIII GGCC 1 cut(s) 451
HapII CCGG 3 cut(s) 329, 438, 448
HhaI GCGC 2 cut(s) 162, 205
Hin1II CATG 2 cut(s) 203, 209
Hin6I GCGC 2 cut(s) 160, 203
HinP1I GCGC 2 cut(s) 160, 203
HincII GTYRAC 2 cut(s) 217, 269
HindII GTYRAC 2 cut(s) 217, 269
HindIII AAGCTT 1 cut(s) 305
HinfI GANTC 1 cut(s) 409
HpaII CCGG 3 cut(s) 329, 438, 448
Hpy166II GTNNAC 2 cut(s) 217, 269
Hpy188I TCNGA 1 cut(s) 247
Hpy188III TCNNGA 2 cut(s) 93, 459
Hpy8I GTNNAC 2 cut(s) 217, 269
HpyCH4V TGCA 2 cut(s) 139, 356
HpyF10VI GCNNNNNNNGC 2 cut(s) 129, 378
HpyF3I CTNAG 2 cut(s) 17, 246
Hsp92II CATG 2 cut(s) 203, 209
HspAI GCGC 2 cut(s) 160, 203
Ksp22I TGATCA 2 cut(s) 259, 300
Kzo9I GATC 2 cut(s) 259, 300
Lsp1109I GCAGC 4 cut(s) 123, 135, 144, 388
LweI GCATC 1 cut(s) 3
MaeI CTAG 4 cut(s) 54, 251, 287, 378
MaeIII GTNAC 1 cut(s) 358
MalI GATC 2 cut(s) 261, 302
MboI GATC 2 cut(s) 259, 300
MboII GAAGA 1 cut(s) 104
MluCI AATT 3 cut(s) 172, 344, 387
MlyI GAGTC 1 cut(s) 403
MnlI CCTC 3 cut(s) 12, 387, 421
MseI TTAA 2 cut(s) 84, 228
MslI CAYNNNNRTG 2 cut(s) 204, 210
MspA1I CMGCKG 1 cut(s) 401
MspI CCGG 3 cut(s) 329, 438, 448
MwoI GCNNNNNNNGC 2 cut(s) 129, 378
NdeII GATC 2 cut(s) 259, 300
NlaIII CATG 2 cut(s) 203, 209
NsbI TGCGCA 1 cut(s) 204
NspI RCATGY 2 cut(s) 203, 209
PaeI GCATGC 1 cut(s) 203
PkrI GCNGC 6 cut(s) 125, 138, 159, 383, 403, 406
PleI GAGTC 1 cut(s) 403
PpsI GAGTC 1 cut(s) 403
PstI CTGCAG 1 cut(s) 358
PvuII CAGCTG 1 cut(s) 401
RseI CAYNNNNRTG 2 cut(s) 204, 210
SaqAI TTAA 2 cut(s) 84, 228
SatI GCNGC 6 cut(s) 124, 137, 158, 382, 402, 405
Sau3AI GATC 2 cut(s) 259, 300
SchI GAGTC 1 cut(s) 403
SetI ASST 8 cut(s) 67, 120, 225, 252, 309, 398, 403, 421
SfaNI GCATC 1 cut(s) 3
SfcI CTRYAG 1 cut(s) 354
SmiMI CAYNNNNRTG 2 cut(s) 204, 210
SphI GCATGC 1 cut(s) 203
Sse9I AATT 3 cut(s) 172, 344, 387
SsiI CCGC 3 cut(s) 372, 382, 404
SspMI CTAG 4 cut(s) 54, 251, 287, 378
TasI AATT 3 cut(s) 172, 344, 387
TauI GCSGC 2 cut(s) 384, 407
Tru1I TTAA 2 cut(s) 84, 228
Tru9I TTAA 2 cut(s) 84, 228
TseI GCWGC 4 cut(s) 123, 136, 157, 401
TspDTI ATGAA 1 cut(s) 114
XceI RCATGY 2 cut(s) 203, 209
XspI CTAG 4 cut(s) 54, 251, 287, 378
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.