Rmu_sc0010766.1_g000005

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010766.1
OG0014610
Physical Location & Seq
Forward (+)
13375 .. 13902
528 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010766.1_g000005.1.cds

Sequence Viewer

Length: 528 bp
atgtcttgcttgaggctgaggcttccaccagccagaaaggcttggaagatcaacaaatccagaaatcaagtcaagccctccactacaatctctattcgagttcggccctacaagtttcttcagctacgcttgcagcgcaaaccacgcttttcgctgcgctttagccagaattgtcgtagcctgctacaaaacaggcatgcacatgtttatgtggacaagctctttaaagagcctgctctctccgagctagttgctgagcgttgtcaacagccgaaaactccaccagccaagtgtgtgatcaagactattgaggatcgctctgtaccagaagcaagcaagcaatctcaatctgcagttggtgagaatagtgagtctgaaggagtaaccagtgctgcagatgatatgtgggagtcactgggatttgcctccccccagatggatggaattgatgaaagagccgaggagtttatagctcggttcagggcagaaatgaaggatcaggagacgttggcccgtcgccatttgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF761

Protein Analysis

175

Amino Acids

20.15

Weight (kDa)

9.87

Isoelectric Point (pI)

66.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014610)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G20500
fragaria_vesca FvH4_2g21490
malus_domestica MD05G1197200.v1.1
prunus_persica Prupe.8G223700_v2.0.a1
pyrus_communis pycom05g18430 pycom10g15920
rosa_chinensis RchiOBHm_Chr6g0288121
rosa_laevigata RLG00000012436
rosa_multiflora Rmu_sc0001851.1_g000029 Rmu_sc0010766.1_g000005
rosa_roxburghii Rroxscaffold_7G00180480
rosa_rugosa Rorug06G0194400.1
rosa_samantha Rh6AG304600 Rh6BG310600 Rh6CG318700 Rh6DG303600
rosa_wichuraiana Rw6G026370

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 321, 504
AcuI CTGAAG 2 cut(s) 104, 396
AfaI GTAC 1 cut(s) 324
AfiI CCNNNNNNNGG 1 cut(s) 436
AflIII ACRYGT 1 cut(s) 202
AluBI AGCT 4 cut(s) 124, 220, 247, 473
AluI AGCT 4 cut(s) 124, 220, 247, 473
Alw26I GTCTC 1 cut(s) 497
AlwI GGATC 2 cut(s) 321, 504
AoxI GGCC 2 cut(s) 104, 510
ApeKI GCWGC 3 cut(s) 133, 154, 392
AspLEI GCGC 2 cut(s) 138, 159
AspS9I GGNCC 2 cut(s) 105, 511
AsuHPI GGTGA 1 cut(s) 371
BbvCI CCTCAGC 1 cut(s) 17
BbvI GCAGC 3 cut(s) 141, 145, 379
BccI CCATC 2 cut(s) 430, 434
BcgI CGANNNNNNTGC 2 cut(s) 233, 267
BclI TGATCA 1 cut(s) 297
BcoDI GTCTC 1 cut(s) 497
BfaI CTAG 1 cut(s) 248
BfmI CTRYAG 2 cut(s) 351, 393
BglI GCCNNNNNGGC 1 cut(s) 38
BisI GCNGC 3 cut(s) 134, 155, 393
BlpI GCTNAGC 1 cut(s) 255
BlsI GCNGC 3 cut(s) 135, 156, 394
BmgT120I GGNCC 2 cut(s) 105, 511
BmrI ACTGGG 1 cut(s) 425
BmuI ACTGGG 1 cut(s) 425
BplI GAGNNNNNCTC 2 cut(s) 302, 334
Bpu10I CCTNAGC 1 cut(s) 17
Bpu1102I GCTNAGC 1 cut(s) 255
BpuEI CTTGAG 1 cut(s) 31
BsaJI CCNNGG 1 cut(s) 459
Bsc4I CCNNNNNNNGG 1 cut(s) 436
Bse1I ACTGG 2 cut(s) 387, 420
BseDI CCNNGG 1 cut(s) 459
BseGI GGATG 1 cut(s) 445
BseLI CCNNNNNNNGG 1 cut(s) 436
BseMII CTCAG 2 cut(s) 8, 246
BseNI ACTGG 2 cut(s) 387, 420
BseRI GAGGAG 1 cut(s) 476
BseXI GCAGC 3 cut(s) 141, 145, 379
BshFI GGCC 2 cut(s) 106, 512
BslI CCNNNNNNNGG 1 cut(s) 436
BsmAI GTCTC 1 cut(s) 497
BsmBI CGTCTC 1 cut(s) 497
BsnI GGCC 2 cut(s) 106, 512
Bsp143I GATC 4 cut(s) 48, 297, 313, 496
Bsp1720I GCTNAGC 1 cut(s) 255
BspANI GGCC 2 cut(s) 106, 512
BspCNI CTCAG 2 cut(s) 9, 247
BspMAI CTGCAG 2 cut(s) 355, 397
BspPI GGATC 2 cut(s) 321, 504
BsrI ACTGG 2 cut(s) 387, 420
BssECI CCNNGG 1 cut(s) 459
BssMI GATC 4 cut(s) 48, 297, 313, 496
BstC8I GCNNGC 6 cut(s) 131, 182, 198, 234, 334, 338
BstDEI CTNAG 2 cut(s) 17, 255
BstF5I GGATG 1 cut(s) 445
BstHHI GCGC 2 cut(s) 138, 159
BstKTI GATC 4 cut(s) 51, 300, 316, 499
BstMAI GTCTC 1 cut(s) 497
BstMBI GATC 4 cut(s) 48, 297, 313, 496
BstMWI GCNNNNNNNGC 4 cut(s) 38, 130, 135, 144
BstNSI RCATGY 2 cut(s) 200, 206
BstSFI CTRYAG 2 cut(s) 351, 393
BstV1I GCAGC 3 cut(s) 141, 145, 379
BstXI CCANNNNNNTGG 1 cut(s) 440
BsuRI GGCC 2 cut(s) 106, 512
BtsCI GGATG 1 cut(s) 445
BtsIMutI CAGTG 2 cut(s) 394, 413
Cac8I GCNNGC 6 cut(s) 131, 182, 198, 234, 334, 338
CfoI GCGC 2 cut(s) 138, 159
Cfr13I GGNCC 2 cut(s) 105, 511
Csp6I GTAC 1 cut(s) 323
CviAII CATG 2 cut(s) 197, 203
CviQI GTAC 1 cut(s) 323
DdeI CTNAG 2 cut(s) 17, 255
DpnI GATC 4 cut(s) 50, 299, 315, 498
DpnII GATC 4 cut(s) 48, 297, 313, 496
DraI TTTAAA 1 cut(s) 226
Eco57I CTGAAG 2 cut(s) 104, 396
Esp3I CGTCTC 1 cut(s) 497
FaeI CATG 2 cut(s) 200, 206
FaiI YATR 5 cut(s) 198, 204, 210, 404, 470
FatI CATG 2 cut(s) 196, 202
FbaI TGATCA 1 cut(s) 297
Fnu4HI GCNGC 3 cut(s) 134, 155, 393
FokI GGATG 1 cut(s) 452
Fsp4HI GCNGC 3 cut(s) 134, 155, 393
FspBI CTAG 1 cut(s) 248
GlaI GCGC 2 cut(s) 137, 158
GluI GCNGC 3 cut(s) 134, 155, 393
HaeIII GGCC 2 cut(s) 106, 512
HhaI GCGC 2 cut(s) 138, 159
Hin1II CATG 2 cut(s) 200, 206
Hin6I GCGC 2 cut(s) 136, 157
HinP1I GCGC 2 cut(s) 136, 157
HincII GTYRAC 1 cut(s) 266
HindII GTYRAC 1 cut(s) 266
HinfI GANTC 2 cut(s) 371, 410
HphI GGTGA 1 cut(s) 371
Hpy166II GTNNAC 2 cut(s) 214, 266
Hpy188I TCNGA 2 cut(s) 244, 376
Hpy188III TCNNGA 3 cut(s) 60, 301, 500
Hpy8I GTNNAC 2 cut(s) 214, 266
Hpy99I CGWCG 1 cut(s) 519
HpyAV CCTTC 2 cut(s) 371, 487
HpyCH4IV ACGT 1 cut(s) 506
HpyCH4V TGCA 4 cut(s) 133, 200, 353, 395
HpyF10VI GCNNNNNNNGC 4 cut(s) 38, 130, 135, 144
HpyF3I CTNAG 2 cut(s) 17, 255
HpySE526I ACGT 1 cut(s) 506
Hsp92II CATG 2 cut(s) 200, 206
HspAI GCGC 2 cut(s) 136, 157
Ksp22I TGATCA 1 cut(s) 297
Kzo9I GATC 4 cut(s) 48, 297, 313, 496
Lsp1109I GCAGC 3 cut(s) 141, 145, 379
MaeI CTAG 1 cut(s) 248
MaeII ACGT 1 cut(s) 506
MaeIII GTNAC 2 cut(s) 382, 411
MalI GATC 4 cut(s) 50, 299, 315, 498
MboI GATC 4 cut(s) 48, 297, 313, 496
MboII GAAGA 2 cut(s) 58, 110
MluCI AATT 2 cut(s) 169, 444
MlyI GAGTC 2 cut(s) 380, 419
MnlI CCTC 6 cut(s) 6, 12, 88, 304, 436, 454
MseI TTAA 1 cut(s) 225
MslI CAYNNNNRTG 2 cut(s) 201, 207
MwoI GCNNNNNNNGC 4 cut(s) 38, 130, 135, 144
NdeII GATC 4 cut(s) 48, 297, 313, 496
NlaIII CATG 2 cut(s) 200, 206
NmeAIII GCCGAG 1 cut(s) 484
NmuCI GTSAC 1 cut(s) 411
NspI RCATGY 2 cut(s) 200, 206
PaeI GCATGC 1 cut(s) 200
PciI ACATGT 1 cut(s) 202
PkrI GCNGC 3 cut(s) 135, 156, 394
PleI GAGTC 2 cut(s) 379, 418
PpsI GAGTC 2 cut(s) 379, 418
PscI ACATGT 1 cut(s) 202
PspPI GGNCC 2 cut(s) 105, 511
PstI CTGCAG 2 cut(s) 355, 397
RsaI GTAC 1 cut(s) 324
RsaNI GTAC 1 cut(s) 323
RseI CAYNNNNRTG 2 cut(s) 201, 207
SaqAI TTAA 1 cut(s) 225
SatI GCNGC 3 cut(s) 134, 155, 393
Sau3AI GATC 4 cut(s) 48, 297, 313, 496
Sau96I GGNCC 2 cut(s) 105, 511
SchI GAGTC 2 cut(s) 380, 419
SetI ASST 5 cut(s) 126, 222, 249, 475, 509
SfcI CTRYAG 2 cut(s) 351, 393
SmiMI CAYNNNNRTG 2 cut(s) 201, 207
SmlI CTYRAG 1 cut(s) 10
SmoI CTYRAG 1 cut(s) 10
SphI GCATGC 1 cut(s) 200
Sse9I AATT 2 cut(s) 169, 444
SspMI CTAG 1 cut(s) 248
TaiI ACGT 1 cut(s) 509
TaqI TCGA 1 cut(s) 97
TasI AATT 2 cut(s) 169, 444
Tru1I TTAA 1 cut(s) 225
Tru9I TTAA 1 cut(s) 225
TscAI CASTG 2 cut(s) 394, 420
TseFI GTSAC 1 cut(s) 411
TseI GCWGC 3 cut(s) 133, 154, 392
Tsp45I GTSAC 1 cut(s) 411
TspDTI ATGAA 2 cut(s) 465, 506
TspRI CASTG 2 cut(s) 394, 420
XceI RCATGY 2 cut(s) 200, 206
XspI CTAG 1 cut(s) 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.