Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002079.1

Orthogroup ID

OG0011493

Physical Location & Seq

Genomic Coordinates Forward (+)

129264 .. 129620

Gene Structure 357 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002079.1_g000028.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 270 bp

atgaaaaagacaccacagagagaagatgaactgacctcgacctctgaacctctgacctcgaagattgtccactgcgtgattgatgaaattgaggttgagtatgctggcaagctcaagtgctttgtgctcaacgcatatgttgatttgcagattgtggaggactatgatattaaggctgtgcctgtggttttgctgtttaacaatgggaggcaatgtgacactacagtggcggagccacattggggcacactgggtcctgtgccccagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004791 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006810 GO:0006950 GO:0006979 GO:0008150 GO:0008152 GO:0009507 GO:0009532 GO:0009536 GO:0009570 GO:0009636 GO:0009987 GO:0010496 GO:0010497 GO:0010646 GO:0010647 GO:0015035 GO:0015036 GO:0016209 GO:0016491 GO:0016651 GO:0016667 GO:0016668 GO:0016671 GO:0019725 GO:0033554 GO:0034599 GO:0042221 GO:0042592 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0045454 GO:0047134 GO:0048509 GO:0048518 GO:0048522 GO:0050789 GO:0050793 GO:0050794 GO:0050896 GO:0051179 GO:0051234 GO:0051716 GO:0055114 GO:0065007 GO:0065008 GO:0070887 GO:0097237 GO:0098754 GO:0098869 GO:1990748

KEGG Pathways

Metabolic & Signaling

ko04621 ko05418 map04621 map05418

Pfam Domains

Protein Families

Thioredoxin

Protein Analysis

89

Amino Acids

9.99

Weight (kDa)

4.69

Isoelectric Point (pI)

38.22

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011493)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G15570 AT2G15570
fragaria_vesca	FvH4_2g05860
malus_domestica	MD05G1082500.v1.1
prunus_persica	Prupe.8G126900_v2.0.a1
pyrus_communis	pycom05g07730
rosa_chinensis	RchiOBHm_Chr6g0257721
rosa_laevigata	RLG00000014718
rosa_multiflora	Rmu_co8430713.1_g000001 Rmu_sc0002079.1_g000028 Rmu_sc0006683.1_g000008 Rmu_sc0011315.1_g000005
rosa_roxburghii	Rroxscaffold_7G00208900
rosa_rugosa	Rorug05G0568800
rosa_samantha	Rh1DG167100 Rh6AG085600 Rh6BG079900 Rh6CG074900 Rh6DG071800
rosa_wichuraiana	Rw6G007680

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	230
AdeI	CACNNNGTG	1 cut(s)	76
AfiI	CCNNNNNNNGG	1 cut(s)	242
AleI	CACNNNNGTG	1 cut(s)	224
AluBI	AGCT	1 cut(s)	112
AluI	AGCT	1 cut(s)	112
Alw21I	GWGCWC	1 cut(s)	129
AspS9I	GGNCC	1 cut(s)	254
AvaII	GGWCC	1 cut(s)	254
BaeGI	GKGCMC	2 cut(s)	248, 264
Bbv12I	GWGCWC	1 cut(s)	129
BfmI	CTRYAG	1 cut(s)	222
Bme18I	GGWCC	1 cut(s)	254
BmgT120I	GGNCC	1 cut(s)	254
BmiI	GGNNCC	2 cut(s)	234, 255
BmrI	ACTGGG	2 cut(s)	259, 260
BmuI	ACTGGG	2 cut(s)	259, 260
BpuEI	CTTGAG	1 cut(s)	98
BsaXI	ACNNNNNCTCC	2 cut(s)	199, 229
Bsc4I	CCNNNNNNNGG	1 cut(s)	242
Bse1I	ACTGG	2 cut(s)	255, 265
Bse3DI	GCAATG	1 cut(s)	218
BseLI	CCNNNNNNNGG	1 cut(s)	242
BseMI	GCAATG	1 cut(s)	218
BseNI	ACTGG	2 cut(s)	255, 265
BseSI	GKGCMC	2 cut(s)	248, 264
BsiHKAI	GWGCWC	1 cut(s)	129
BslI	CCNNNNNNNGG	1 cut(s)	242
Bsp1286I	GDGCHC	3 cut(s)	129, 248, 264
BspACI	CCGC	1 cut(s)	230
BspLI	GGNNCC	2 cut(s)	234, 255
BsrDI	GCAATG	1 cut(s)	218
BsrI	ACTGG	2 cut(s)	255, 265
Bst4CI	ACNGT	1 cut(s)	226
BstC8I	GCNNGC	2 cut(s)	106, 110
BstSFI	CTRYAG	1 cut(s)	222
BstSLI	GKGCMC	2 cut(s)	248, 264
BtsI	GCAGTG	1 cut(s)	70
BtsIMutI	CAGTG	3 cut(s)	70, 231, 248
Cac8I	GCNNGC	2 cut(s)	106, 110
Cfr13I	GGNCC	1 cut(s)	254
CviJI	RGCY	3 cut(s)	112, 176, 235
CviKI_1	RGCY	3 cut(s)	112, 176, 235
DraIII	CACNNNGTG	1 cut(s)	76
EciI	GGCGGA	1 cut(s)	245
Eco47I	GGWCC	1 cut(s)	254
EcoO109I	RGGNCCY	1 cut(s)	254
FaiI	YATR	4 cut(s)	102, 136, 138, 165
FauNDI	CATATG	1 cut(s)	136
Hpy166II	GTNNAC	1 cut(s)	70
Hpy188I	TCNGA	2 cut(s)	46, 54
Hpy8I	GTNNAC	1 cut(s)	70
HpyCH4III	ACNGT	1 cut(s)	226
HpyCH4V	TGCA	1 cut(s)	148
LmnI	GCTCC	1 cut(s)	232
LpnPI	CCDG	3 cut(s)	90, 195, 236
MaeIII	GTNAC	1 cut(s)	215
MboII	GAAGA	2 cut(s)	35, 73
MhlI	GDGCHC	3 cut(s)	129, 248, 264
MluCI	AATT	1 cut(s)	87
MnlI	CCTC	7 cut(s)	46, 52, 60, 67, 85, 151, 201
MseI	TTAA	2 cut(s)	171, 198
MslI	CAYNNNNRTG	1 cut(s)	224
NdeI	CATATG	1 cut(s)	136
NlaIV	GGNNCC	2 cut(s)	234, 255
NmuCI	GTSAC	1 cut(s)	215
OliI	CACNNNNGTG	1 cut(s)	224
PpuMI	RGGWCCY	1 cut(s)	254
Psp5II	RGGWCCY	1 cut(s)	254
PspN4I	GGNNCC	2 cut(s)	234, 255
PspPI	GGNCC	1 cut(s)	254
PspPPI	RGGWCCY	1 cut(s)	254
RseI	CAYNNNNRTG	1 cut(s)	224
SaqAI	TTAA	2 cut(s)	171, 198
Sau96I	GGNCC	1 cut(s)	254
SduI	GDGCHC	3 cut(s)	129, 248, 264
SetI	ASST	6 cut(s)	38, 44, 52, 59, 96, 114
SfcI	CTRYAG	1 cut(s)	222
SgeI	CNNG	8 cut(s)	49, 70, 88, 117, 121, 127, 194, 263
SinI	GGWCC	1 cut(s)	254
SmiMI	CAYNNNNRTG	1 cut(s)	224
SmlI	CTYRAG	1 cut(s)	113
SmoI	CTYRAG	1 cut(s)	113
Sse9I	AATT	1 cut(s)	87
SsiI	CCGC	1 cut(s)	230
TaaI	ACNGT	1 cut(s)	226
TaqI	TCGA	2 cut(s)	38, 59
TasI	AATT	1 cut(s)	87
Tru1I	TTAA	2 cut(s)	171, 198
Tru9I	TTAA	2 cut(s)	171, 198
TscAI	CASTG	3 cut(s)	77, 231, 255
TseFI	GTSAC	1 cut(s)	215
Tsp45I	GTSAC	1 cut(s)	215
TspDTI	ATGAA	3 cut(s)	17, 42, 99
TspRI	CASTG	3 cut(s)	77, 231, 255
VpaK11BI	GGWCC	1 cut(s)	254

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.