Rmu_sc0002372.1_g000015

Domain of unknown function (DUF4228)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002372.1
OG0014305
Physical Location & Seq
Reverse (-)
88465 .. 90797
2333 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002372.1_g000015.1.cds

Sequence Viewer

Length: 540 bp
atgggcaactgtcaggcggcggaggcggcgacggtgattattcaccacccggccaacaacaaggtcgagaggatttactggtcggtgagcgctcacgagatcatgacgtcgaatccggggaactacgtggcgcttgtggtgacgtcgccgacgttgaaggccgagaatggcgcgccggttaagcagctcaagcttctcaggccggacgacactttacttatcggacaggtttaccggctcatcagtttcgaagatgtgttgaaagagtttgctgctaaaaagtctgtgaagctggggaggttgctgagggatagcggtggccttggcctggaactgaagaaaaaagacttgcatggtccgaatccgaattcgaagtccgacgaccgcaattctaccaagatggagcatgaggctcaccgtgtcggaagcagcagtagtggtggttgtggtggtggcagcagcagaggtatggcgaggaatcatggtggtggggggcagtggaggccagctttgcagagcattgcagaacttgggacttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4228

Protein Analysis

179

Amino Acids

19.12

Weight (kDa)

9.45

Isoelectric Point (pI)

30.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014305)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G67620
fragaria_vesca FvH4_1g17910
malus_domestica MD02G1187500.v1.1 MD15G1298400.v1.1
prunus_persica Prupe.6G219300_v2.0.a1
pyrus_communis pycom02g15250
rosa_chinensis RchiOBHm_Chr2g0108341
rosa_laevigata RLG00000017662
rosa_multiflora Rmu_sc0002372.1_g000015
rosa_roxburghii Rroxscaffold_2G00135230
rosa_rugosa Rorug02G0152200
rosa_samantha Rh2AG201100 Rh2BG214000 Rh2CG205400 Rh2DG208500
rosa_wichuraiana Rw2G016010 Rw2G016070

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 2 cut(s) 110, 146
AccII CGCG 1 cut(s) 173
AciI CCGC 5 cut(s) 17, 20, 26, 315, 385
AcoI YGGCCR 1 cut(s) 51
AcsI RAATTY 1 cut(s) 367
AcuI CTGAAG 1 cut(s) 356
AcyI GRCGYC 2 cut(s) 107, 143
AfeI AGCGCT 1 cut(s) 91
AfiI CCNNNNNNNGG 1 cut(s) 328
AgsI TTSAA 2 cut(s) 157, 262
AjnI CCWGG 1 cut(s) 327
AluBI AGCT 4 cut(s) 187, 193, 292, 509
AluI AGCT 4 cut(s) 187, 193, 292, 509
Aor51HI AGCGCT 1 cut(s) 91
AoxI GGCC 6 cut(s) 51, 159, 200, 319, 325, 503
ApeKI GCWGC 5 cut(s) 184, 272, 429, 456, 459
ApoI RAATTY 1 cut(s) 367
ArsI GACNNNNNNTTYG 2 cut(s) 359, 391
AscI GGCGCGCC 1 cut(s) 171
AspLEI GCGC 4 cut(s) 92, 133, 173, 175
AspS9I GGNCC 1 cut(s) 356
AsuC2I CCSGG 2 cut(s) 50, 117
AsuHPI GGTGA 5 cut(s) 35, 46, 97, 151, 407
AsuII TTCGAA 2 cut(s) 249, 371
AvaII GGWCC 1 cut(s) 356
BauI CACGAG 1 cut(s) 95
BbvCI CCTCAGC 1 cut(s) 305
BbvI GCAGC 5 cut(s) 196, 259, 441, 468, 471
BccI CCATC 1 cut(s) 394
BciT130I CCWGG 1 cut(s) 329
BcnI CCSGG 2 cut(s) 50, 117
BfoI RGCGCY 2 cut(s) 93, 134
BisI GCNGC 7 cut(s) 18, 27, 185, 273, 430, 457, 460
BlsI GCNGC 7 cut(s) 19, 28, 186, 274, 431, 458, 461
Bme1390I CCNGG 3 cut(s) 50, 117, 329
Bme18I GGWCC 1 cut(s) 356
BmgT120I GGNCC 1 cut(s) 356
BmrFI CCNGG 3 cut(s) 50, 117, 329
Bpu10I CCTNAGC 1 cut(s) 305
Bpu14I TTCGAA 2 cut(s) 249, 371
BpuEI CTTGAG 1 cut(s) 173
BpuMI CCSGG 2 cut(s) 50, 117
BsaAI YACGTR 1 cut(s) 127
BsaHI GRCGYC 2 cut(s) 107, 143
BsaJI CCNNGG 2 cut(s) 116, 322
Bsc4I CCNNNNNNNGG 1 cut(s) 328
Bse118I RCCGGY 2 cut(s) 175, 234
Bse1I ACTGG 1 cut(s) 83
Bse3DI GCAATG 1 cut(s) 519
BseBI CCWGG 1 cut(s) 329
BseDI CCNNGG 2 cut(s) 116, 322
BseLI CCNNNNNNNGG 1 cut(s) 328
BseMI GCAATG 1 cut(s) 519
BseMII CTCAG 2 cut(s) 211, 296
BseNI ACTGG 1 cut(s) 83
BsePI GCGCGC 1 cut(s) 171
BseXI GCAGC 5 cut(s) 196, 259, 441, 468, 471
BseYI CCCAGC 1 cut(s) 292
Bsh1236I CGCG 1 cut(s) 173
Bsh1285I CGRYCG 1 cut(s) 385
BshFI GGCC 6 cut(s) 53, 161, 202, 321, 327, 505
BsiEI CGRYCG 1 cut(s) 385
BsiSI CCGG 5 cut(s) 50, 116, 176, 203, 235
BslI CCNNNNNNNGG 1 cut(s) 328
BsnI GGCC 6 cut(s) 53, 161, 202, 321, 327, 505
Bsp119I TTCGAA 2 cut(s) 249, 371
Bsp143I GATC 1 cut(s) 99
BspACI CCGC 5 cut(s) 17, 20, 26, 315, 385
BspANI GGCC 6 cut(s) 53, 161, 202, 321, 327, 505
BspCNI CTCAG 2 cut(s) 210, 297
BspFNI CGCG 1 cut(s) 173
BspHI TCATGA 1 cut(s) 102
BspT104I TTCGAA 2 cut(s) 249, 371
BsrDI GCAATG 1 cut(s) 519
BsrFI RCCGGY 2 cut(s) 175, 234
BsrI ACTGG 1 cut(s) 83
BssAI RCCGGY 2 cut(s) 175, 234
BssECI CCNNGG 2 cut(s) 116, 322
BssHII GCGCGC 1 cut(s) 171
BssMI GATC 1 cut(s) 99
BssNI GRCGYC 2 cut(s) 107, 143
BssSI CACGAG 1 cut(s) 95
BssT1I CCWWGG 1 cut(s) 322
Bst2BI CACGAG 1 cut(s) 95
Bst2UI CCWGG 1 cut(s) 329
Bst4CI ACNGT 3 cut(s) 11, 34, 419
BstACI GRCGYC 2 cut(s) 107, 143
BstBAI YACGTR 1 cut(s) 127
BstBI TTCGAA 2 cut(s) 249, 371
BstC8I GCNNGC 2 cut(s) 173, 507
BstDEI CTNAG 2 cut(s) 197, 305
BstFNI CGCG 1 cut(s) 173
BstH2I RGCGCY 2 cut(s) 93, 134
BstHHI GCGC 4 cut(s) 92, 133, 173, 175
BstKTI GATC 1 cut(s) 102
BstMBI GATC 1 cut(s) 99
BstMCI CGRYCG 1 cut(s) 385
BstMWI GCNNNNNNNGC 7 cut(s) 23, 26, 181, 190, 199, 502, 511
BstNI CCWGG 1 cut(s) 329
BstSCI CCNGG 3 cut(s) 48, 115, 327
BstUI CGCG 1 cut(s) 173
BstV1I GCAGC 5 cut(s) 196, 259, 441, 468, 471
BsuRI GGCC 6 cut(s) 53, 161, 202, 321, 327, 505
BtsI GCAGTG 1 cut(s) 503
BtsIMutI CAGTG 1 cut(s) 503
Cac8I GCNNGC 2 cut(s) 173, 507
CciI TCATGA 1 cut(s) 102
CfoI GCGC 4 cut(s) 92, 133, 173, 175
Cfr10I RCCGGY 2 cut(s) 175, 234
Cfr13I GGNCC 1 cut(s) 356
CviAII CATG 4 cut(s) 103, 353, 407, 482
DdeI CTNAG 2 cut(s) 197, 305
DpnI GATC 1 cut(s) 101
DpnII GATC 1 cut(s) 99
EaeI YGGCCR 1 cut(s) 51
EciI GGCGGA 1 cut(s) 35
Eco130I CCWWGG 1 cut(s) 322
Eco47I GGWCC 1 cut(s) 356
Eco47III AGCGCT 1 cut(s) 91
Eco57I CTGAAG 1 cut(s) 356
EcoRI GAATTC 1 cut(s) 367
EcoRII CCWGG 1 cut(s) 327
EcoT14I CCWWGG 1 cut(s) 322
ErhI CCWWGG 1 cut(s) 322
FaeI CATG 4 cut(s) 106, 356, 410, 485
FaiI YATR 5 cut(s) 104, 354, 408, 470, 483
FatI CATG 4 cut(s) 102, 352, 406, 481
Fnu4HI GCNGC 7 cut(s) 18, 27, 185, 273, 430, 457, 460
Fsp4HI GCNGC 7 cut(s) 18, 27, 185, 273, 430, 457, 460
GlaI GCGC 4 cut(s) 91, 132, 172, 174
GluI GCNGC 7 cut(s) 18, 27, 185, 273, 430, 457, 460
GsaI CCCAGC 1 cut(s) 296
HaeII RGCGCY 2 cut(s) 93, 134
HaeIII GGCC 6 cut(s) 53, 161, 202, 321, 327, 505
HapII CCGG 5 cut(s) 50, 116, 176, 203, 235
HhaI GCGC 4 cut(s) 92, 133, 173, 175
Hin1I GRCGYC 2 cut(s) 107, 143
Hin1II CATG 4 cut(s) 106, 356, 410, 485
Hin6I GCGC 4 cut(s) 90, 131, 171, 173
HinP1I GCGC 4 cut(s) 90, 131, 171, 173
HindIII AAGCTT 1 cut(s) 191
HinfI GANTC 3 cut(s) 112, 361, 478
HpaII CCGG 5 cut(s) 50, 116, 176, 203, 235
HphI GGTGA 5 cut(s) 35, 46, 97, 151, 407
Hpy166II GTNNAC 1 cut(s) 232
Hpy188I TCNGA 5 cut(s) 224, 360, 366, 379, 425
Hpy188III TCNNGA 3 cut(s) 67, 95, 103
Hpy8I GTNNAC 1 cut(s) 232
Hpy99I CGWCG 5 cut(s) 34, 112, 148, 154, 383
HpyAV CCTTC 1 cut(s) 151
HpyCH4III ACNGT 3 cut(s) 11, 34, 419
HpyCH4IV ACGT 4 cut(s) 107, 126, 143, 152
HpyCH4V TGCA 3 cut(s) 352, 514, 524
HpyF10VI GCNNNNNNNGC 7 cut(s) 23, 26, 181, 190, 199, 502, 511
HpyF3I CTNAG 2 cut(s) 197, 305
HpySE526I ACGT 4 cut(s) 107, 126, 143, 152
Hsp92I GRCGYC 2 cut(s) 107, 143
Hsp92II CATG 4 cut(s) 106, 356, 410, 485
HspAI GCGC 4 cut(s) 90, 131, 171, 173
Kzo9I GATC 1 cut(s) 99
LmnI GCTCC 1 cut(s) 403
Lsp1109I GCAGC 5 cut(s) 196, 259, 441, 468, 471
MaeII ACGT 4 cut(s) 107, 126, 143, 152
MaeIII GTNAC 1 cut(s) 139
MalI GATC 1 cut(s) 101
MboI GATC 1 cut(s) 99
MboII GAAGA 2 cut(s) 263, 349
MluCI AATT 2 cut(s) 367, 388
MmeI TCCRAC 2 cut(s) 402, 403
MnlI CCTC 8 cut(s) 16, 63, 291, 300, 403, 458, 468, 495
MseI TTAA 1 cut(s) 180
MslI CAYNNNNRTG 1 cut(s) 486
MspI CCGG 5 cut(s) 50, 116, 176, 203, 235
MspR9I CCNGG 3 cut(s) 50, 117, 329
MvaI CCWGG 1 cut(s) 329
MvnI CGCG 1 cut(s) 173
MwoI GCNNNNNNNGC 7 cut(s) 23, 26, 181, 190, 199, 502, 511
NciI CCSGG 2 cut(s) 50, 117
NdeII GATC 1 cut(s) 99
NlaIII CATG 4 cut(s) 106, 356, 410, 485
NmeAIII GCCGAG 1 cut(s) 187
NmuCI GTSAC 1 cut(s) 139
NspV TTCGAA 2 cut(s) 249, 371
PagI TCATGA 1 cut(s) 102
PalAI GGCGCGCC 1 cut(s) 171
PauI GCGCGC 1 cut(s) 171
PcsI WCGNNNNNNNCGW 1 cut(s) 149
PfeI GAWTC 3 cut(s) 112, 361, 478
PkrI GCNGC 7 cut(s) 19, 28, 186, 274, 431, 458, 461
Ppu21I YACGTR 1 cut(s) 127
Psp6I CCWGG 1 cut(s) 327
PspFI CCCAGC 1 cut(s) 292
PspGI CCWGG 1 cut(s) 327
PspPI GGNCC 1 cut(s) 356
PteI GCGCGC 1 cut(s) 171
RseI CAYNNNNRTG 1 cut(s) 486
SaqAI TTAA 1 cut(s) 180
SatI GCNGC 7 cut(s) 18, 27, 185, 273, 430, 457, 460
Sau3AI GATC 1 cut(s) 99
Sau96I GGNCC 1 cut(s) 356
ScrFI CCNGG 3 cut(s) 50, 117, 329
SfuI TTCGAA 2 cut(s) 249, 371
SgsI GGCGCGCC 1 cut(s) 171
SinI GGWCC 1 cut(s) 356
SmiMI CAYNNNNRTG 1 cut(s) 486
SmlI CTYRAG 1 cut(s) 188
SmoI CTYRAG 1 cut(s) 188
Sse9I AATT 2 cut(s) 367, 388
SsiI CCGC 5 cut(s) 17, 20, 26, 315, 385
StyD4I CCNGG 3 cut(s) 48, 115, 327
StyI CCWWGG 1 cut(s) 322
TaaI ACNGT 3 cut(s) 11, 34, 419
TaiI ACGT 4 cut(s) 110, 129, 146, 155
TaqI TCGA 4 cut(s) 66, 110, 249, 371
TasI AATT 2 cut(s) 367, 388
TauI GCSGC 2 cut(s) 20, 29
TfiI GAWTC 3 cut(s) 112, 361, 478
Tru1I TTAA 1 cut(s) 180
Tru9I TTAA 1 cut(s) 180
TscAI CASTG 1 cut(s) 503
TseFI GTSAC 1 cut(s) 139
TseI GCWGC 5 cut(s) 184, 272, 429, 456, 459
Tsp45I GTSAC 1 cut(s) 139
TspRI CASTG 1 cut(s) 503
VpaK11BI GGWCC 1 cut(s) 356
XapI RAATTY 1 cut(s) 367
ZraI GACGTC 2 cut(s) 108, 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.