Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002451.1

Orthogroup ID

OG0016020

Physical Location & Seq

Genomic Coordinates Reverse (-)

122110 .. 129458

Gene Structure 7349 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002451.1_g000031.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 558 bp

atgaagtatcacatggagaacacagaagccttcctgaggctctcttcagttatcctcttggtcctcactgcgttactagtaggacttgatcaccagaccaaatttgtcttcttcacttacagaaaagcttcttttgacgaggtcaaagccctcctggttctagtttatgttgatgctgtggttgctggatacaatctggttcgactgttgggcaagtgttcaatgtcagctggtttagtcaaacaaaatccacaagggtccagcctatacgtagcttggctttctctattgctcgatcagatagcagtatatgtggcgtttggggcaaactcagctgcgtttcaggcttcagtgatagcattaacaggcatatcagaatttcagtggatgaagttgtgcaacaaatactccagattctgctttcaaatgggtggagccttgtcatgtggatacctagcatgccttctcttgatttccatatccttcatcactgcctttaatctgtttaggctttactcacccaagaaactgtttctcttaaagagcatatcagggtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0048037 GO:0051536 GO:0051540

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF588

Protein Analysis

185

Amino Acids

20.5

Weight (kDa)

9.34

Isoelectric Point (pI)

26.19

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016020)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G25830
fragaria_vesca	FvH4_4g09300
malus_domestica	MD13G1269300.v1.1
prunus_persica	Prupe.1G088100_v2.0.a1
pyrus_communis	pycom13g22330
rosa_chinensis	RchiOBHm_Chr4g0402761
rosa_laevigata	RLG00000009048
rosa_multiflora	Rmu_sc0002451.1_g000031
rosa_roxburghii	Rroxscaffold_5G00347520
rosa_rugosa	Rorug04G0038600
rosa_samantha	Rh4AG116000 Rh4BG108600 Rh4CG123300 Rh4DG108800
rosa_wichuraiana	Rw4G009280

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	2 cut(s)	101, 377
AcuI	CTGAAG	2 cut(s)	30, 333
AfiI	CCNNNNNNNGG	1 cut(s)	36
AgsI	TTSAA	2 cut(s)	222, 425
AhlI	ACTAGT	1 cut(s)	76
AjnI	CCWGG	1 cut(s)	153
AjuI	GAANNNNNNNTTGG	2 cut(s)	92, 124
AluBI	AGCT	4 cut(s)	128, 230, 275, 335
AluI	AGCT	4 cut(s)	128, 230, 275, 335
AlwNI	CAGNNNCTG	1 cut(s)	417
ApeKI	GCWGC	1 cut(s)	335
ApoI	RAATTY	2 cut(s)	101, 377
Asp700I	GAANNNNTTC	1 cut(s)	127
AspS9I	GGNCC	2 cut(s)	61, 258
AsuHPI	GGTGA	2 cut(s)	83, 510
AvaII	GGWCC	2 cut(s)	61, 258
AxyI	CCTNAGG	1 cut(s)	35
BbsI	GAAGAC	1 cut(s)	100
BbvI	GCAGC	1 cut(s)	322
BciT130I	CCWGG	1 cut(s)	155
BciVI	GTATCC	2 cut(s)	182, 443
BclI	TGATCA	1 cut(s)	88
BcuI	ACTAGT	1 cut(s)	76
BfaI	CTAG	3 cut(s)	77, 161, 455
BfuI	GTATCC	2 cut(s)	182, 443
BisI	GCNGC	1 cut(s)	336
BlsI	GCNGC	1 cut(s)	337
Bme1390I	CCNGG	1 cut(s)	155
Bme18I	GGWCC	2 cut(s)	61, 258
BmgT120I	GGNCC	2 cut(s)	61, 258
BmiI	GGNNCC	2 cut(s)	259, 436
BmrFI	CCNGG	1 cut(s)	155
BmsI	GCATC	1 cut(s)	163
BpiI	GAAGAC	1 cut(s)	100
BpmI	CTGGAG	1 cut(s)	394
BsaAI	YACGTR	1 cut(s)	271
BsaXI	ACNNNNNCTCC	2 cut(s)	392, 422
Bsc4I	CCNNNNNNNGG	1 cut(s)	36
Bse21I	CCTNAGG	1 cut(s)	35
BseBI	CCWGG	1 cut(s)	155
BseGI	GGATG	1 cut(s)	393
BseLI	CCNNNNNNNGG	1 cut(s)	36
BseMII	CTCAG	2 cut(s)	26, 345
BseXI	GCAGC	1 cut(s)	322
BslI	CCNNNNNNNGG	1 cut(s)	36
Bsp143I	GATC	2 cut(s)	88, 295
BspCNI	CTCAG	2 cut(s)	27, 344
BspLI	GGNNCC	2 cut(s)	259, 436
BssMI	GATC	2 cut(s)	88, 295
Bst2UI	CCWGG	1 cut(s)	155
Bst4CI	ACNGT	2 cut(s)	207, 531
Bst6I	CTCTTC	1 cut(s)	49
BstBAI	YACGTR	1 cut(s)	271
BstC8I	GCNNGC	1 cut(s)	460
BstDEI	CTNAG	2 cut(s)	35, 331
BstENI	CCTNNNNNAGG	1 cut(s)	34
BstF5I	GGATG	1 cut(s)	393
BstKTI	GATC	2 cut(s)	91, 298
BstMBI	GATC	2 cut(s)	88, 295
BstMWI	GCNNNNNNNGC	4 cut(s)	182, 323, 332, 344
BstNI	CCWGG	1 cut(s)	155
BstNSI	RCATGY	1 cut(s)	462
BstSCI	CCNGG	1 cut(s)	153
BstSNI	TACGTA	1 cut(s)	271
BstV1I	GCAGC	1 cut(s)	322
BstV2I	GAAGAC	1 cut(s)	100
Bsu36I	CCTNAGG	1 cut(s)	35
BsuI	GTATCC	2 cut(s)	182, 443
BtsCI	GGATG	1 cut(s)	393
BtsI	GCAGTG	2 cut(s)	66, 489
BtsIMutI	CAGTG	4 cut(s)	66, 357, 389, 489
Cac8I	GCNNGC	1 cut(s)	460
CaiI	CAGNNNCTG	1 cut(s)	417
Cfr13I	GGNCC	2 cut(s)	61, 258
CviAII	CATG	3 cut(s)	13, 444, 459
DdeI	CTNAG	2 cut(s)	35, 331
DpnI	GATC	2 cut(s)	90, 297
DpnII	GATC	2 cut(s)	88, 295
Eam1104I	CTCTTC	1 cut(s)	49
EarI	CTCTTC	1 cut(s)	49
Eco105I	TACGTA	1 cut(s)	271
Eco47I	GGWCC	2 cut(s)	61, 258
Eco57I	CTGAAG	2 cut(s)	30, 333
Eco81I	CCTNAGG	1 cut(s)	35
EcoNI	CCTNNNNNAGG	1 cut(s)	34
EcoRII	CCWGG	1 cut(s)	153
FaeI	CATG	3 cut(s)	16, 447, 462
FatI	CATG	3 cut(s)	12, 443, 458
FbaI	TGATCA	1 cut(s)	88
Fnu4HI	GCNGC	1 cut(s)	336
FokI	GGATG	1 cut(s)	400
Fsp4HI	GCNGC	1 cut(s)	336
FspBI	CTAG	3 cut(s)	77, 161, 455
GluI	GCNGC	1 cut(s)	336
GsuI	CTGGAG	1 cut(s)	394
Hin1II	CATG	3 cut(s)	16, 447, 462
HindIII	AAGCTT	1 cut(s)	126
HinfI	GANTC	1 cut(s)	414
HphI	GGTGA	2 cut(s)	83, 510
Hpy188I	TCNGA	2 cut(s)	300, 376
Hpy188III	TCNNGA	3 cut(s)	34, 411, 469
HpyAV	CCTTC	3 cut(s)	40, 473, 493
HpyCH4III	ACNGT	2 cut(s)	207, 531
HpyCH4IV	ACGT	1 cut(s)	270
HpyCH4V	TGCA	1 cut(s)	399
HpyF10VI	GCNNNNNNNGC	4 cut(s)	182, 323, 332, 344
HpyF3I	CTNAG	2 cut(s)	35, 331
HpySE526I	ACGT	1 cut(s)	270
Hsp92II	CATG	3 cut(s)	16, 447, 462
Ksp22I	TGATCA	1 cut(s)	88
Kzo9I	GATC	2 cut(s)	88, 295
LmnI	GCTCC	1 cut(s)	434
Lsp1109I	GCAGC	1 cut(s)	322
LweI	GCATC	1 cut(s)	163
MaeI	CTAG	3 cut(s)	77, 161, 455
MaeII	ACGT	1 cut(s)	270
MaeIII	GTNAC	1 cut(s)	72
MalI	GATC	2 cut(s)	90, 297
MboI	GATC	2 cut(s)	88, 295
MboII	GAAGA	3 cut(s)	36, 100, 103
MluCI	AATT	2 cut(s)	101, 377
MnlI	CCTC	5 cut(s)	30, 65, 74, 133, 161
MroXI	GAANNNNTTC	1 cut(s)	127
MseI	TTAA	3 cut(s)	362, 498, 539
MspA1I	CMGCKG	2 cut(s)	230, 335
MspR9I	CCNGG	1 cut(s)	155
MvaI	CCWGG	1 cut(s)	155
MwoI	GCNNNNNNNGC	4 cut(s)	182, 323, 332, 344
NdeII	GATC	2 cut(s)	88, 295
NlaIII	CATG	3 cut(s)	16, 447, 462
NlaIV	GGNNCC	2 cut(s)	259, 436
NspI	RCATGY	1 cut(s)	462
PaeI	GCATGC	1 cut(s)	462
PdmI	GAANNNNTTC	1 cut(s)	127
PfeI	GAWTC	1 cut(s)	414
PflFI	GACNNNGTC	1 cut(s)	140
PkrI	GCNGC	1 cut(s)	337
Ppu21I	YACGTR	1 cut(s)	271
Psp6I	CCWGG	1 cut(s)	153
PspGI	CCWGG	1 cut(s)	153
PspN4I	GGNNCC	2 cut(s)	259, 436
PspPI	GGNCC	2 cut(s)	61, 258
PstNI	CAGNNNCTG	1 cut(s)	417
PsyI	GACNNNGTC	1 cut(s)	140
PvuII	CAGCTG	2 cut(s)	230, 335
SaqAI	TTAA	3 cut(s)	362, 498, 539
SatI	GCNGC	1 cut(s)	336
Sau3AI	GATC	2 cut(s)	88, 295
Sau96I	GGNCC	2 cut(s)	61, 258
ScrFI	CCNGG	1 cut(s)	155
SetI	ASST	7 cut(s)	130, 144, 232, 273, 277, 337, 456
SfaNI	GCATC	1 cut(s)	163
SinI	GGWCC	2 cut(s)	61, 258
SnaBI	TACGTA	1 cut(s)	271
SpeI	ACTAGT	1 cut(s)	76
SphI	GCATGC	1 cut(s)	462
Sse9I	AATT	2 cut(s)	101, 377
SspMI	CTAG	3 cut(s)	77, 161, 455
StyD4I	CCNGG	1 cut(s)	153
TaaI	ACNGT	2 cut(s)	207, 531
TaiI	ACGT	1 cut(s)	273
TaqI	TCGA	2 cut(s)	202, 294
TasI	AATT	2 cut(s)	101, 377
TfiI	GAWTC	1 cut(s)	414
Tru1I	TTAA	3 cut(s)	362, 498, 539
Tru9I	TTAA	3 cut(s)	362, 498, 539
TscAI	CASTG	4 cut(s)	73, 357, 389, 496
TseI	GCWGC	1 cut(s)	335
TspDTI	ATGAA	3 cut(s)	17, 404, 475
TspRI	CASTG	4 cut(s)	73, 357, 389, 496
Tth111I	GACNNNGTC	1 cut(s)	140
VpaK11BI	GGWCC	2 cut(s)	61, 258
XagI	CCTNNNNNAGG	1 cut(s)	34
XapI	RAATTY	2 cut(s)	101, 377
XceI	RCATGY	1 cut(s)	462
XmnI	GAANNNNTTC	1 cut(s)	127
XspI	CTAG	3 cut(s)	77, 161, 455

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.