Rmu_sc0002484.1_g000002

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002484.1
Physical Location & Seq
Forward (+)
12658 .. 13422
765 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002484.1_g000002.1.cds

Sequence Viewer

Length: 765 bp
atggaaaagaatggcaatggtactagtactactacagattcatcaggagtgtgtgagaaactcttcagtgccattacagccaattctgcttttcaaacaatcctccgaatctcctctcctgctagagatcgttccccactggcaaacctcaatcatgctgccggaaagaaaataattgatatccaaagcaaacctcaacagtccaacaagtcggcagtgattcaggttcccatcaagtttgaaaagaaggaggttctgcagcctgctagtactccaaatgagaatagaggaaagttgtcaacctcacacaaggctgctgctaagattgaacctggaccagcacaggtggcccaaaagaaggtaattgctattgaacacattgctcatggccaggaaggcaagaaggagaagcacaagaccaagtccgagtcattgcaggcaaaaggaggagcagttggggaggggcaacatatcaatgctactatgaaagttgtgaaagcacaagaagtacaagttaagaatgatggtaagaaaccaggaggagtggatattaatgataagttttctgaatatatcactcgtgctaagatcaagatcagaaccatgtcatcaaagaagatacaagaatctgatcaggagggtattgatggtggtaaggacgtccatttttctgcttttattgatcgtgcaaagaacaagttcaaatctagcaaatcgaatgttggtggtaccggaaagactgtctcatttaagagagatcagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

254

Amino Acids

27.38

Weight (kDa)

9.91

Isoelectric Point (pI)

37.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016761)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g24090
prunus_persica Prupe.8G247000_v2.0.a1
pyrus_communis pycom03g21550 pycom11g25820
rosa_chinensis RchiOBHm_Chr6g0291871
rosa_laevigata RLG00000012081
rosa_multiflora Rmu_sc0002484.1_g000002
rosa_roxburghii Rroxscaffold_7G00175670
rosa_rugosa Rorug06G0221700
rosa_samantha Rh6AG335000 Rh6BG342400 Rh6CG348400 Rh6DG335200
rosa_wichuraiana Rw6G029150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 663
Acc65I GGTACC 1 cut(s) 728
AccB1I GGYRCC 1 cut(s) 728
AcoI YGGCCR 1 cut(s) 388
AcuI CTGAAG 1 cut(s) 49
AcyI GRCGYC 1 cut(s) 660
AfaI GTAC 5 cut(s) 22, 28, 271, 510, 730
AfiI CCNNNNNNNGG 1 cut(s) 358
AgsI TTSAA 5 cut(s) 95, 242, 329, 374, 703
AhlI ACTAGT 1 cut(s) 23
AjnI CCWGG 3 cut(s) 331, 390, 535
Alw26I GTCTC 1 cut(s) 748
AoxI GGCC 2 cut(s) 348, 388
ApeKI GCWGC 4 cut(s) 158, 259, 314, 317
AseI ATTAAT 1 cut(s) 552
Asp700I GAANNNNTTC 2 cut(s) 62, 698
Asp718I GGTACC 1 cut(s) 728
AspS9I GGNCC 2 cut(s) 335, 349
AvaII GGWCC 1 cut(s) 335
BalI TGGCCA 1 cut(s) 390
BanI GGYRCC 1 cut(s) 728
BauI CACGAG 1 cut(s) 579
BbvI GCAGC 4 cut(s) 145, 271, 301, 304
BccI CCATC 3 cut(s) 239, 518, 641
BciT130I CCWGG 3 cut(s) 333, 392, 537
BclI TGATCA 1 cut(s) 631
BcoDI GTCTC 1 cut(s) 748
BcuI ACTAGT 1 cut(s) 23
BfaI CTAG 4 cut(s) 24, 123, 267, 708
BfmI CTRYAG 2 cut(s) 33, 257
BglI GCCNNNNNGGC 1 cut(s) 396
BisI GCNGC 4 cut(s) 159, 260, 315, 318
BlsI GCNGC 4 cut(s) 160, 261, 316, 319
BmcAI AGTACT 2 cut(s) 28, 271
Bme1390I CCNGG 3 cut(s) 333, 392, 537
Bme18I GGWCC 1 cut(s) 335
BmgT120I GGNCC 2 cut(s) 335, 349
BmiI GGNNCC 2 cut(s) 228, 730
BmrFI CCNGG 3 cut(s) 333, 392, 537
BsaBI GATNNNNATC 1 cut(s) 593
BsaHI GRCGYC 1 cut(s) 660
BsaWI WCCGGW 1 cut(s) 731
BsaXI ACNNNNNCTCC 2 cut(s) 438, 468
Bsc4I CCNNNNNNNGG 1 cut(s) 358
Bse1I ACTGG 1 cut(s) 144
Bse3DI GCAATG 3 cut(s) 22, 378, 431
Bse8I GATNNNNATC 1 cut(s) 593
BseBI CCWGG 3 cut(s) 333, 392, 537
BseJI GATNNNNATC 1 cut(s) 593
BseLI CCNNNNNNNGG 1 cut(s) 358
BseMI GCAATG 3 cut(s) 22, 378, 431
BseNI ACTGG 1 cut(s) 144
BseRI GAGGAG 3 cut(s) 103, 462, 555
BseXI GCAGC 4 cut(s) 145, 271, 301, 304
BshFI GGCC 2 cut(s) 350, 390
BshNI GGYRCC 1 cut(s) 728
BsiSI CCGG 2 cut(s) 162, 732
BslI CCNNNNNNNGG 1 cut(s) 358
BsmAI GTCTC 1 cut(s) 748
BsnI GGCC 2 cut(s) 350, 390
Bsp143I GATC 6 cut(s) 127, 588, 594, 631, 682, 757
BspANI GGCC 2 cut(s) 350, 390
BspLI GGNNCC 2 cut(s) 228, 730
BspMAI CTGCAG 1 cut(s) 261
BspT107I GGYRCC 1 cut(s) 728
BsrDI GCAATG 3 cut(s) 22, 378, 431
BsrI ACTGG 1 cut(s) 144
BssMI GATC 6 cut(s) 127, 588, 594, 631, 682, 757
BssNI GRCGYC 1 cut(s) 660
BssSI CACGAG 1 cut(s) 579
Bst2BI CACGAG 1 cut(s) 579
Bst2UI CCWGG 3 cut(s) 333, 392, 537
Bst4CI ACNGT 2 cut(s) 201, 742
Bst6I CTCTTC 1 cut(s) 68
BstACI GRCGYC 1 cut(s) 660
BstC8I GCNNGC 2 cut(s) 264, 438
BstDEI CTNAG 2 cut(s) 321, 585
BstKTI GATC 6 cut(s) 130, 591, 597, 634, 685, 760
BstMAI GTCTC 1 cut(s) 748
BstMBI GATC 6 cut(s) 127, 588, 594, 631, 682, 757
BstMWI GCNNNNNNNGC 4 cut(s) 77, 86, 347, 396
BstNI CCWGG 3 cut(s) 333, 392, 537
BstSCI CCNGG 3 cut(s) 331, 390, 535
BstSFI CTRYAG 2 cut(s) 33, 257
BstV1I GCAGC 4 cut(s) 145, 271, 301, 304
BsuRI GGCC 2 cut(s) 350, 390
BtsI GCAGTG 1 cut(s) 222
BtsIMutI CAGTG 3 cut(s) 73, 137, 222
Cac8I GCNNGC 2 cut(s) 264, 438
Cfr13I GGNCC 2 cut(s) 335, 349
Csp6I GTAC 5 cut(s) 21, 27, 270, 509, 729
CviAII CATG 3 cut(s) 155, 386, 604
CviJI RGCY 5 cut(s) 80, 262, 314, 350, 390
CviKI_1 RGCY 5 cut(s) 80, 262, 314, 350, 390
CviQI GTAC 5 cut(s) 21, 27, 270, 509, 729
DdeI CTNAG 2 cut(s) 321, 585
DpnI GATC 6 cut(s) 129, 590, 596, 633, 684, 759
DpnII GATC 6 cut(s) 127, 588, 594, 631, 682, 757
EaeI YGGCCR 1 cut(s) 388
Eam1104I CTCTTC 1 cut(s) 68
EarI CTCTTC 1 cut(s) 68
Eco32I GATATC 1 cut(s) 181
Eco47I GGWCC 1 cut(s) 335
Eco57I CTGAAG 1 cut(s) 49
EcoRII CCWGG 3 cut(s) 331, 390, 535
EcoRV GATATC 1 cut(s) 181
FaeI CATG 3 cut(s) 158, 389, 607
FaiI YATR 6 cut(s) 156, 387, 471, 485, 573, 605
FatI CATG 3 cut(s) 154, 385, 603
FbaI TGATCA 1 cut(s) 631
Fnu4HI GCNGC 4 cut(s) 159, 260, 315, 318
Fsp4HI GCNGC 4 cut(s) 159, 260, 315, 318
FspBI CTAG 4 cut(s) 24, 123, 267, 708
GluI GCNGC 4 cut(s) 159, 260, 315, 318
HaeIII GGCC 2 cut(s) 350, 390
HapII CCGG 2 cut(s) 162, 732
Hin1I GRCGYC 1 cut(s) 660
Hin1II CATG 3 cut(s) 158, 389, 607
HincII GTYRAC 1 cut(s) 300
HindII GTYRAC 1 cut(s) 300
HinfI GANTC 5 cut(s) 38, 108, 220, 428, 626
HpaII CCGG 2 cut(s) 162, 732
Hpy166II GTNNAC 1 cut(s) 300
Hpy188I TCNGA 5 cut(s) 107, 427, 568, 599, 631
Hpy188III TCNNGA 3 cut(s) 45, 592, 635
Hpy8I GTNNAC 1 cut(s) 300
HpyAV CCTTC 4 cut(s) 241, 352, 389, 397
HpyCH4III ACNGT 2 cut(s) 201, 742
HpyCH4IV ACGT 1 cut(s) 660
HpyCH4V TGCA 3 cut(s) 259, 436, 689
HpyF10VI GCNNNNNNNGC 4 cut(s) 77, 86, 347, 396
HpyF3I CTNAG 2 cut(s) 321, 585
HpySE526I ACGT 1 cut(s) 660
Hsp92I GRCGYC 1 cut(s) 660
Hsp92II CATG 3 cut(s) 158, 389, 607
KpnI GGTACC 1 cut(s) 732
Ksp22I TGATCA 1 cut(s) 631
Kzo9I GATC 6 cut(s) 127, 588, 594, 631, 682, 757
LmnI GCTCC 1 cut(s) 449
Lsp1109I GCAGC 4 cut(s) 145, 271, 301, 304
MaeI CTAG 4 cut(s) 24, 123, 267, 708
MaeII ACGT 1 cut(s) 660
MalI GATC 6 cut(s) 129, 590, 596, 633, 684, 759
MboI GATC 6 cut(s) 127, 588, 594, 631, 682, 757
MboII GAAGA 2 cut(s) 55, 628
MlsI TGGCCA 1 cut(s) 390
MluCI AATT 3 cut(s) 82, 174, 363
MluNI TGGCCA 1 cut(s) 390
MlyI GAGTC 1 cut(s) 437
MmeI TCCRAC 1 cut(s) 228
Mox20I TGGCCA 1 cut(s) 390
MroXI GAANNNNTTC 2 cut(s) 62, 698
MscI TGGCCA 1 cut(s) 390
MseI TTAA 3 cut(s) 516, 552, 750
MslI CAYNNNNRTG 1 cut(s) 474
Msp20I TGGCCA 1 cut(s) 390
MspI CCGG 2 cut(s) 162, 732
MspR9I CCNGG 3 cut(s) 333, 392, 537
MvaI CCWGG 3 cut(s) 333, 392, 537
MwoI GCNNNNNNNGC 4 cut(s) 77, 86, 347, 396
NdeII GATC 6 cut(s) 127, 588, 594, 631, 682, 757
NlaIII CATG 3 cut(s) 158, 389, 607
NlaIV GGNNCC 2 cut(s) 228, 730
PdmI GAANNNNTTC 2 cut(s) 62, 698
PfeI GAWTC 4 cut(s) 38, 108, 220, 626
PflFI GACNNNGTC 1 cut(s) 421
PkrI GCNGC 4 cut(s) 160, 261, 316, 319
PleI GAGTC 1 cut(s) 436
PpsI GAGTC 1 cut(s) 436
PshBI ATTAAT 1 cut(s) 552
Psp6I CCWGG 3 cut(s) 331, 390, 535
PspGI CCWGG 3 cut(s) 331, 390, 535
PspN4I GGNNCC 2 cut(s) 228, 730
PspPI GGNCC 2 cut(s) 335, 349
PstI CTGCAG 1 cut(s) 261
PsyI GACNNNGTC 1 cut(s) 421
RsaI GTAC 5 cut(s) 22, 28, 271, 510, 730
RsaNI GTAC 5 cut(s) 21, 27, 270, 509, 729
RseI CAYNNNNRTG 1 cut(s) 474
SaqAI TTAA 3 cut(s) 516, 552, 750
SatI GCNGC 4 cut(s) 159, 260, 315, 318
Sau3AI GATC 6 cut(s) 127, 588, 594, 631, 682, 757
Sau96I GGNCC 2 cut(s) 335, 349
ScaI AGTACT 2 cut(s) 28, 271
SchI GAGTC 1 cut(s) 437
ScrFI CCNGG 3 cut(s) 333, 392, 537
SetI ASST 9 cut(s) 150, 196, 228, 255, 305, 334, 348, 363, 663
SfcI CTRYAG 2 cut(s) 33, 257
SinI GGWCC 1 cut(s) 335
SmiMI CAYNNNNRTG 1 cut(s) 474
SpeI ACTAGT 1 cut(s) 23
Sse9I AATT 3 cut(s) 82, 174, 363
SspMI CTAG 4 cut(s) 24, 123, 267, 708
StyD4I CCNGG 3 cut(s) 331, 390, 535
TaaI ACNGT 2 cut(s) 201, 742
TaiI ACGT 1 cut(s) 663
TaqI TCGA 1 cut(s) 716
TasI AATT 3 cut(s) 82, 174, 363
TatI WGTACW 3 cut(s) 26, 269, 508
TfiI GAWTC 4 cut(s) 38, 108, 220, 626
Tru1I TTAA 3 cut(s) 516, 552, 750
Tru9I TTAA 3 cut(s) 516, 552, 750
TscAI CASTG 3 cut(s) 73, 144, 222
TseI GCWGC 4 cut(s) 158, 259, 314, 317
TspDTI ATGAA 2 cut(s) 30, 500
TspRI CASTG 3 cut(s) 73, 144, 222
Tth111I GACNNNGTC 1 cut(s) 421
VpaK11BI GGWCC 1 cut(s) 335
VspI ATTAAT 1 cut(s) 552
XmnI GAANNNNTTC 2 cut(s) 62, 698
XspI CTAG 4 cut(s) 24, 123, 267, 708
ZraI GACGTC 1 cut(s) 661
ZrmI AGTACT 2 cut(s) 28, 271
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.