Rmu_sc0002527.1_g000003

RNA-binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002527.1
OG0015504
Physical Location & Seq
Forward (+)
19118 .. 23038
3921 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002527.1_g000003.1.cds

Sequence Viewer

Length: 798 bp
atgtgggcagctccagtctcttttccatcgtacaactatggaaaacccattaacactcttcaatcttctgggtcaaatcgtagggtgcccaagtctttgaggctcagagcttccttctacgactatcctctcgcaagcagaatcatggtcaaaaatataccatattccaccagtgaaaatagtttgcagcagaagttttcaaatttcggagagatagctgaagttaaactagtgaaggatgaaacttcaaagaggtctaaggggtttgcatttattcaatataccagtcaagatgatgcaatgcttgccctggaaaacatggaccaccagacttttgatggcagggtcatctatgtagagcttgcaaaacctggtaaagatgcttatgcaggatacccaaaaacatctggacccccaaagaagcagtatatgcagcagcaagaggaagttacagactgctgtcgttatgactactcgtcgatgacacttttcttccaaatacttgaatgggtttctcatctctcttccctaaaatatctcaatcttggaggactaaaccttggcagcagcgttggaacacttgatgattcatctatttacaagggcaatccatcactttgtggggttcctcttttaaccaagtgcccaggagacgacacacctatagcacaaactttcctggagaagactaaagatgagattgataacggaaagcttggtttctatgttagcatcattctcgggtttgtcataggattttggggtgtttgtggcacgttactcataaagaagtcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RRM_1

Protein Analysis

265

Amino Acids

29.57

Weight (kDa)

8.44

Isoelectric Point (pI)

41.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015504)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G20030
fragaria_vesca FvH4_3g12730
malus_domestica MD10G1228700.v1.1
prunus_persica Prupe.4G116100_v2.0.a1
pyrus_communis pycom10g19220
rosa_chinensis RchiOBHm_Chr5g0020731
rosa_laevigata RLG00000032556
rosa_multiflora Rmu_sc0002527.1_g000003
rosa_roxburghii Rroxscaffold_1G00057570 Rroxscaffold_1G00057580
rosa_rugosa Rorug05G0062600
rosa_samantha Rh5AG152400 Rh5BG152100 Rh5CG163600 Rh5DG151600
rosa_wichuraiana Rw5G013510

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 85
AcsI RAATTY 1 cut(s) 202
AcuI CTGAAG 1 cut(s) 240
AdeI CACNNNGTG 1 cut(s) 620
AfaI GTAC 1 cut(s) 32
AgsI TTSAA 5 cut(s) 62, 201, 249, 278, 506
AhdI GACNNNNNGTC 1 cut(s) 475
AhlI ACTAGT 1 cut(s) 229
AjnI CCWGG 4 cut(s) 309, 370, 646, 678
AluBI AGCT 5 cut(s) 11, 110, 218, 361, 715
AluI AGCT 5 cut(s) 11, 110, 218, 361, 715
Alw26I GTCTC 2 cut(s) 22, 645
Ama87I CYCGRG 1 cut(s) 740
ApeKI GCWGC 6 cut(s) 8, 187, 433, 436, 564, 567
ApoI RAATTY 1 cut(s) 202
AspS9I GGNCC 2 cut(s) 322, 410
AvaI CYCGRG 1 cut(s) 740
AvaII GGWCC 2 cut(s) 322, 410
BaeGI GKGCMC 2 cut(s) 90, 647
BanI GGYRCC 1 cut(s) 85
BbsI GAAGAC 1 cut(s) 692
BbvI GCAGC 6 cut(s) 20, 199, 445, 448, 576, 579
BccI CCATC 3 cut(s) 34, 332, 619
BcgI CGANNNNNNTGC 2 cut(s) 721, 755
BciT130I CCWGG 4 cut(s) 311, 372, 648, 680
BciVI GTATCC 1 cut(s) 386
BcoDI GTCTC 2 cut(s) 22, 645
BcuI ACTAGT 1 cut(s) 229
BfaI CTAG 1 cut(s) 230
BfmI CTRYAG 1 cut(s) 663
BfuI GTATCC 1 cut(s) 386
BisI GCNGC 6 cut(s) 9, 188, 434, 437, 565, 568
BlsI GCNGC 6 cut(s) 10, 189, 435, 438, 566, 569
Bme1390I CCNGG 4 cut(s) 311, 372, 648, 680
Bme18I GGWCC 2 cut(s) 322, 410
BmeRI GACNNNNNGTC 1 cut(s) 475
BmeT110I CYCGRG 1 cut(s) 740
BmgT120I GGNCC 2 cut(s) 322, 410
BmiI GGNNCC 3 cut(s) 87, 412, 627
BmrFI CCNGG 4 cut(s) 311, 372, 648, 680
BmsI GCATC 3 cut(s) 286, 370, 741
BoxI GACNNNNGTC 1 cut(s) 459
BpiI GAAGAC 1 cut(s) 692
BpmI CTGGAG 1 cut(s) 701
BsaJI CCNNGG 3 cut(s) 309, 559, 646
Bse1I ACTGG 3 cut(s) 14, 171, 285
Bse3DI GCAATG 1 cut(s) 306
BseBI CCWGG 4 cut(s) 311, 372, 648, 680
BseDI CCNNGG 3 cut(s) 309, 559, 646
BseGI GGATG 1 cut(s) 244
BseMI GCAATG 1 cut(s) 306
BseMII CTCAG 1 cut(s) 118
BseNI ACTGG 3 cut(s) 14, 171, 285
BseSI GKGCMC 2 cut(s) 90, 647
BseXI GCAGC 6 cut(s) 20, 199, 445, 448, 576, 579
BshNI GGYRCC 1 cut(s) 85
BsiHKCI CYCGRG 1 cut(s) 740
BsmAI GTCTC 2 cut(s) 22, 645
BsmBI CGTCTC 1 cut(s) 645
BsoBI CYCGRG 1 cut(s) 740
Bsp1286I GDGCHC 2 cut(s) 90, 647
BspCNI CTCAG 1 cut(s) 117
BspHI TCATGA 1 cut(s) 794
BspLI GGNNCC 3 cut(s) 87, 412, 627
BspT107I GGYRCC 1 cut(s) 85
BsrDI GCAATG 1 cut(s) 306
BsrI ACTGG 3 cut(s) 14, 171, 285
BssECI CCNNGG 3 cut(s) 309, 559, 646
BssT1I CCWWGG 1 cut(s) 559
Bst2UI CCWGG 4 cut(s) 311, 372, 648, 680
Bst6I CTCTTC 2 cut(s) 63, 529
BstAPI GCANNNNNTGC 2 cut(s) 305, 430
BstC8I GCNNGC 3 cut(s) 136, 306, 363
BstDEI CTNAG 2 cut(s) 104, 258
BstF5I GGATG 1 cut(s) 244
BstMAI GTCTC 2 cut(s) 22, 645
BstMWI GCNNNNNNNGC 2 cut(s) 305, 430
BstNI CCWGG 4 cut(s) 311, 372, 648, 680
BstPAI GACNNNNGTC 1 cut(s) 459
BstSCI CCNGG 4 cut(s) 309, 370, 646, 678
BstSFI CTRYAG 1 cut(s) 663
BstSLI GKGCMC 2 cut(s) 90, 647
BstV1I GCAGC 6 cut(s) 20, 199, 445, 448, 576, 579
BstV2I GAAGAC 1 cut(s) 692
BsuI GTATCC 1 cut(s) 386
BtsCI GGATG 1 cut(s) 244
BtsIMutI CAGTG 1 cut(s) 178
Cac8I GCNNGC 3 cut(s) 136, 306, 363
CciI TCATGA 1 cut(s) 794
Cfr13I GGNCC 2 cut(s) 322, 410
CsiI ACCWGGT 1 cut(s) 370
Csp6I GTAC 1 cut(s) 31
CviAII CATG 3 cut(s) 145, 319, 795
CviJI RGCY 6 cut(s) 11, 103, 110, 218, 361, 715
CviKI_1 RGCY 6 cut(s) 11, 103, 110, 218, 361, 715
CviQI GTAC 1 cut(s) 31
DdeI CTNAG 2 cut(s) 104, 258
DraIII CACNNNGTG 1 cut(s) 620
DriI GACNNNNNGTC 1 cut(s) 475
Eam1104I CTCTTC 2 cut(s) 63, 529
Eam1105I GACNNNNNGTC 1 cut(s) 475
EarI CTCTTC 2 cut(s) 63, 529
Eco130I CCWWGG 1 cut(s) 559
Eco47I GGWCC 2 cut(s) 322, 410
Eco57I CTGAAG 1 cut(s) 240
Eco88I CYCGRG 1 cut(s) 740
EcoRII CCWGG 4 cut(s) 309, 370, 646, 678
EcoT14I CCWWGG 1 cut(s) 559
ErhI CCWWGG 1 cut(s) 559
Esp3I CGTCTC 1 cut(s) 645
FaeI CATG 3 cut(s) 148, 322, 798
FatI CATG 3 cut(s) 144, 318, 794
Fnu4HI GCNGC 6 cut(s) 9, 188, 434, 437, 565, 568
FokI GGATG 1 cut(s) 251
Fsp4HI GCNGC 6 cut(s) 9, 188, 434, 437, 565, 568
FspBI CTAG 1 cut(s) 230
GluI GCNGC 6 cut(s) 9, 188, 434, 437, 565, 568
GsuI CTGGAG 1 cut(s) 701
Hin1II CATG 3 cut(s) 148, 322, 798
HindIII AAGCTT 1 cut(s) 713
HinfI GANTC 2 cut(s) 141, 587
Hpy188I TCNGA 2 cut(s) 107, 209
Hpy188III TCNNGA 3 cut(s) 290, 408, 795
Hpy99I CGWCG 1 cut(s) 481
HpyAV CCTTC 2 cut(s) 124, 229
HpyCH4IV ACGT 1 cut(s) 776
HpyCH4V TGCA 6 cut(s) 187, 269, 299, 365, 389, 433
HpyF10VI GCNNNNNNNGC 2 cut(s) 305, 430
HpyF3I CTNAG 2 cut(s) 104, 258
HpySE526I ACGT 1 cut(s) 776
Hsp92II CATG 3 cut(s) 148, 322, 798
LmnI GCTCC 1 cut(s) 16
Lsp1109I GCAGC 6 cut(s) 20, 199, 445, 448, 576, 579
LweI GCATC 3 cut(s) 286, 370, 741
MabI ACCWGGT 1 cut(s) 370
MaeI CTAG 1 cut(s) 230
MaeII ACGT 1 cut(s) 776
MaeIII GTNAC 2 cut(s) 448, 777
MboII GAAGA 5 cut(s) 50, 57, 484, 516, 697
MhlI GDGCHC 2 cut(s) 90, 647
MluCI AATT 1 cut(s) 202
MmeI TCCRAC 1 cut(s) 553
MnlI CCTC 6 cut(s) 93, 138, 246, 436, 542, 639
MseI TTAA 3 cut(s) 51, 225, 635
MspR9I CCNGG 4 cut(s) 311, 372, 648, 680
MvaI CCWGG 4 cut(s) 311, 372, 648, 680
MwoI GCNNNNNNNGC 2 cut(s) 305, 430
NlaIII CATG 3 cut(s) 148, 322, 798
NlaIV GGNNCC 3 cut(s) 87, 412, 627
PagI TCATGA 1 cut(s) 794
PfeI GAWTC 2 cut(s) 141, 587
PfoI TCCNGGA 1 cut(s) 678
PkrI GCNGC 6 cut(s) 10, 189, 435, 438, 566, 569
PshAI GACNNNNGTC 1 cut(s) 459
Psp6I CCWGG 4 cut(s) 309, 370, 646, 678
PspGI CCWGG 4 cut(s) 309, 370, 646, 678
PspN4I GGNNCC 3 cut(s) 87, 412, 627
PspPI GGNCC 2 cut(s) 322, 410
RsaI GTAC 1 cut(s) 32
RsaNI GTAC 1 cut(s) 31
SaqAI TTAA 3 cut(s) 51, 225, 635
SatI GCNGC 6 cut(s) 9, 188, 434, 437, 565, 568
Sau96I GGNCC 2 cut(s) 322, 410
ScrFI CCNGG 4 cut(s) 311, 372, 648, 680
SduI GDGCHC 2 cut(s) 90, 647
SexAI ACCWGGT 1 cut(s) 370
SfaNI GCATC 3 cut(s) 286, 370, 741
SfcI CTRYAG 1 cut(s) 663
SinI GGWCC 2 cut(s) 322, 410
SpeI ACTAGT 1 cut(s) 229
Sse9I AATT 1 cut(s) 202
SspMI CTAG 1 cut(s) 230
StyD4I CCNGG 4 cut(s) 309, 370, 646, 678
StyI CCWWGG 1 cut(s) 559
TaiI ACGT 1 cut(s) 779
TaqI TCGA 1 cut(s) 479
TasI AATT 1 cut(s) 202
TfiI GAWTC 2 cut(s) 141, 587
Tru1I TTAA 3 cut(s) 51, 225, 635
Tru9I TTAA 3 cut(s) 51, 225, 635
TscAI CASTG 1 cut(s) 178
TseI GCWGC 6 cut(s) 8, 187, 433, 436, 564, 567
TspDTI ATGAA 2 cut(s) 255, 579
TspGWI ACGGA 1 cut(s) 723
TspRI CASTG 1 cut(s) 178
VpaK11BI GGWCC 2 cut(s) 322, 410
XapI RAATTY 1 cut(s) 202
XcmI CCANNNNNNNNNTGG 1 cut(s) 335
XspI CTAG 1 cut(s) 230
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.