Rmu_sc0002547.1_g000021

Methyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002547.1
OG0011678
Physical Location & Seq
Forward (+)
99116 .. 101509
2394 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002547.1_g000021.1.cds

Sequence Viewer

Length: 1914 bp
atggcgttggggaataggtcgcgcagtagcagtaacaagcggtcgtcttcaagctcttacacatcaaccgtgatggtaatgggattcatagcactgtgtgtggttggtgtgtggatgatgaattactccagcgctggagtttcaacacaaaccaccacggctcgaaccaacaccgtcacttccactgcctcctcggatgaaaacaatacacaagccgctgagaataacaataataacaatgagaaacccaaggcatttgaagacaatcccggtgatcttccggacgatgccataaaaaatgatgatgggcctaacaaatcggatgctgctgctatcaacgagggaaagacgtccagagaaaaacaagagcaagatgcagctgaagaacagaaagaggatcagaagcagcaagagcttaaccaagcacagttatctgaggaaaccactatacctgaaaaccaacaagctgaacaaaccgccacacaagagaagatcatcactgctgatgatcaacctgacgagaaaaaccatcaacaaaaaaacaataacggcggccagagcggtggaaatgatcaaatagatttagaaagcaaacctcaagagcaacctgcagaaacaaattccgataatagcaagcaaaataataatgctcaagcttttcaggacaaaaaaccggggaatgcagatcaaactcagatgcaacaacaacaacaacaacaggagcagcagcaaccactaaaacaccagcaccaacaacaacaacaagaagagcagtcgctaggtgttgaaagaaatgaaaattcacaggagtcccagaataatattcaaggctcgtcaaatcaacaacaacaacagcagcagcagcaggagaatcagcatcaacatcatagtcaggaacaagagcatcatgaccaacaaaaaccgcaacaatacaccgacgagacaaaccatgtcacaacgctaccaactatacctgaccagaatgaacaaaagaaaaaccaaggagaacaacaacaacaacaacaacaacagcaacaagaagaatcttaccctcagcgaaagaaaggtaatgcagcagctgatcaaaacaataagggcaccgagtccaactcgggcgaaacgctactcaacggcggggacagctcgggcattccgaaagagtcaaaggagtcgaagaagtcgtggaggactcaagcggatcagtcggagaacgagaaggagaggcgcaaggacgaaaaggagggtcaagatagcatctacgggtacacgtggcagctttgcaatgtgactgcaggtcctgattatataccttgtttggacaatgagaaggctataaagaagctgcgttctaccaaacacttccagcatcgagagaggcattgtccgcaggagggtcccacttgcctggttccacatccggagggttacaagacgtctatccagtggccgaaaagcagagacaagatatggtatcacaatgtaccgcacacattgctggcggaggtgaagggacaccagaactgggttaaggtgtccggtgagtttttgacttttccgggtggtgggacccaattcatacatggcgctctcctctacattgatttccttcaaaacgcagtaccgaatctcgcatggggaaagcacactcgagttatactggacgttgggtgtggtgttgcgagctttgggggttatctctttgacagagatgttcttacaatgtcttttgcacccaaagatgagcatgaagctcaagttcagtttgccctggaaaggggtattccagccatttcagcagtcatgggtactcagaggctgcccttccccagcagggtctttgatgccgtccactgtgcacgttgcagagtgccttggcacctcgaaggttctgtccatcataattacgtggtttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Methyltransf_29

Protein Analysis

637

Amino Acids

71.71

Weight (kDa)

5.36

Isoelectric Point (pI)

49.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011678)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G51070 AT3G51070
fragaria_vesca FvH4_1g12411
malus_domestica MD02G1136800.v1.1 MD15G1250600.v1.1
prunus_persica Prupe.7G163700_v2.0.a1
pyrus_communis pycom15g22090
rosa_chinensis RchiOBHm_Chr2g0100281
rosa_laevigata RLG00000016952
rosa_multiflora Rmu_sc0002547.1_g000021 Rmu_sc0002547.1_g000022
rosa_roxburghii Rroxscaffold_2G00142420
rosa_rugosa Rorug02G0087100 Rorug02G0087200
rosa_samantha Rh2AG136100 Rh2BG139700 Rh2CG141400 Rh2DG141600
rosa_wichuraiana Rw2G010650

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 2 cut(s) 353, 1436
Acc36I ACCTGC 2 cut(s) 616, 1283
AccB1I GGYRCC 2 cut(s) 1097, 1875
AccBSI CCGCTC 1 cut(s) 561
AccII CGCG 1 cut(s) 22
AccIII TCCGGA 2 cut(s) 280, 1417
AclWI GGATC 2 cut(s) 405, 1206
AcoI YGGCCR 2 cut(s) 553, 1445
AcsI RAATTY 2 cut(s) 619, 799
AcuI CTGAAG 1 cut(s) 402
AcvI CACGTG 1 cut(s) 1269
AcyI GRCGYC 2 cut(s) 350, 1433
AdeI CACNNNGTG 1 cut(s) 98
AfaI GTAC 4 cut(s) 1265, 1482, 1620, 1807
AfeI AGCGCT 1 cut(s) 133
AfiI CCNNNNNNNGG 6 cut(s) 1391, 1522, 1562, 1773, 1774, 1831
AflIII ACRYGT 1 cut(s) 1266
AgsI TTSAA 6 cut(s) 51, 144, 260, 788, 827, 1610
AhdI GACNNNNNGTC 1 cut(s) 1293
AjnI CCWGG 2 cut(s) 1404, 1767
Alw21I GWGCWC 1 cut(s) 1858
Alw26I GTCTC 2 cut(s) 935, 1452
Alw44I GTGCAC 1 cut(s) 1854
AlwI GGATC 2 cut(s) 405, 1206
AlwNI CAGNNNCTG 3 cut(s) 1079, 1298, 1816
Ama87I CYCGRG 3 cut(s) 1111, 1144, 1647
Aor13HI TCCGGA 2 cut(s) 280, 1417
Aor51HI AGCGCT 1 cut(s) 133
AoxI GGCC 3 cut(s) 308, 553, 1445
ApaLI GTGCAC 1 cut(s) 1854
ApoI RAATTY 2 cut(s) 619, 799
ArsI GACNNNNNNTTYG 2 cut(s) 1875, 1907
AspLEI GCGC 4 cut(s) 24, 134, 1227, 1586
AspS9I GGNCC 4 cut(s) 308, 1295, 1394, 1566
AsuC2I CCSGG 3 cut(s) 270, 675, 1557
AsuHPI GGTGA 3 cut(s) 284, 1516, 1550
AvaI CYCGRG 3 cut(s) 1111, 1144, 1647
AvaII GGWCC 3 cut(s) 1295, 1394, 1566
BaeGI GKGCMC 2 cut(s) 1100, 1858
BanI GGYRCC 2 cut(s) 1097, 1875
BbrPI CACGTG 1 cut(s) 1269
BbsI GAAGAC 2 cut(s) 39, 267
Bbv12I GWGCWC 1 cut(s) 1858
BbvCI CCTCAGC 1 cut(s) 1053
BccI CCATC 4 cut(s) 67, 299, 537, 1902
BceAI ACGGC 4 cut(s) 174, 565, 1147, 1829
BciT130I CCWGG 2 cut(s) 1406, 1769
BclI TGATCA 3 cut(s) 508, 571, 1081
BcnI CCSGG 3 cut(s) 270, 675, 1557
BcoDI GTCTC 2 cut(s) 935, 1452
BfaI CTAG 1 cut(s) 779
BfmI CTRYAG 2 cut(s) 609, 1290
BfoI RGCGCY 2 cut(s) 135, 1587
BfuAI ACCTGC 2 cut(s) 616, 1283
Bme1390I CCNGG 5 cut(s) 270, 675, 1406, 1557, 1769
Bme18I GGWCC 3 cut(s) 1295, 1394, 1566
BmeRI GACNNNNNGTC 1 cut(s) 1293
BmeT110I CYCGRG 3 cut(s) 1111, 1144, 1647
BmgT120I GGNCC 4 cut(s) 308, 1295, 1394, 1566
BmiI GGNNCC 7 cut(s) 1099, 1395, 1396, 1410, 1567, 1568, 1877
BmrFI CCNGG 5 cut(s) 270, 675, 1406, 1557, 1769
BmrI ACTGGG 1 cut(s) 1531
BmsI GCATC 9 cut(s) 277, 313, 364, 687, 886, 913, 1263, 1375, 1831
BmuI ACTGGG 1 cut(s) 1531
BpiI GAAGAC 2 cut(s) 39, 267
BplI GAGNNNNNCTC 2 cut(s) 1094, 1126
BpmI CTGGAG 2 cut(s) 112, 156
Bpu10I CCTNAGC 1 cut(s) 1053
BpuEI CTTGAG 4 cut(s) 582, 636, 1176, 1737
BpuMI CCSGG 3 cut(s) 270, 675, 1557
BsaAI YACGTR 2 cut(s) 1269, 1906
BsaHI GRCGYC 2 cut(s) 350, 1433
BsaJI CCNNGG 7 cut(s) 156, 192, 249, 674, 1000, 1767, 1871
BsaWI WCCGGW 3 cut(s) 280, 1417, 1535
Bsc4I CCNNNNNNNGG 6 cut(s) 1391, 1522, 1562, 1773, 1774, 1831
Bse1I ACTGG 3 cut(s) 1441, 1526, 1662
Bse3DI GCAATG 2 cut(s) 1288, 1490
BseAI TCCGGA 2 cut(s) 280, 1417
BseBI CCWGG 2 cut(s) 1406, 1769
BseDI CCNNGG 7 cut(s) 156, 192, 249, 674, 1000, 1767, 1871
BseGI GGATG 4 cut(s) 120, 202, 328, 1414
BseLI CCNNNNNNNGG 6 cut(s) 1391, 1522, 1562, 1773, 1774, 1831
BseMI GCAATG 2 cut(s) 1288, 1490
BseMII CTCAG 5 cut(s) 210, 426, 707, 1067, 1823
BseNI ACTGG 3 cut(s) 1441, 1526, 1662
BseRI GAGGAG 2 cut(s) 181, 1580
BseSI GKGCMC 2 cut(s) 1100, 1858
BseYI CCCAGC 1 cut(s) 1826
Bsh1236I CGCG 1 cut(s) 22
Bsh1285I CGRYCG 1 cut(s) 44
BshFI GGCC 3 cut(s) 310, 555, 1447
BshNI GGYRCC 2 cut(s) 1097, 1875
BsiEI CGRYCG 1 cut(s) 44
BsiHKAI GWGCWC 1 cut(s) 1858
BsiHKCI CYCGRG 3 cut(s) 1111, 1144, 1647
BsiSI CCGG 6 cut(s) 270, 281, 674, 1418, 1536, 1556
BslFI GGGAC 5 cut(s) 796, 1151, 1380, 1524, 1579
BslI CCNNNNNNNGG 6 cut(s) 1391, 1522, 1562, 1773, 1774, 1831
BsmAI GTCTC 2 cut(s) 935, 1452
BsmFI GGGAC 5 cut(s) 796, 1151, 1380, 1524, 1579
BsmI GAATGC 2 cut(s) 685, 1149
BsnI GGCC 3 cut(s) 310, 555, 1447
BsoBI CYCGRG 3 cut(s) 1111, 1144, 1647
Bsp1286I GDGCHC 2 cut(s) 1100, 1858
Bsp13I TCCGGA 2 cut(s) 280, 1417
Bsp143I GATC 8 cut(s) 274, 397, 492, 508, 571, 685, 1081, 1198
BspANI GGCC 3 cut(s) 310, 555, 1447
BspCNI CTCAG 5 cut(s) 211, 427, 706, 1066, 1822
BspEI TCCGGA 2 cut(s) 280, 1417
BspFNI CGCG 1 cut(s) 22
BspHI TCATGA 1 cut(s) 907
BspLI GGNNCC 7 cut(s) 1099, 1395, 1396, 1410, 1567, 1568, 1877
BspMAI CTGCAG 2 cut(s) 613, 1294
BspMI ACCTGC 2 cut(s) 616, 1283
BspPI GGATC 2 cut(s) 405, 1206
BspQI GCTCTTC 1 cut(s) 762
BspT107I GGYRCC 2 cut(s) 1097, 1875
BsrBI CCGCTC 1 cut(s) 561
BsrDI GCAATG 2 cut(s) 1288, 1490
BsrI ACTGG 3 cut(s) 1441, 1526, 1662
BssECI CCNNGG 7 cut(s) 156, 192, 249, 674, 1000, 1767, 1871
BssMI GATC 8 cut(s) 274, 397, 492, 508, 571, 685, 1081, 1198
BssNI GRCGYC 2 cut(s) 350, 1433
BssT1I CCWWGG 3 cut(s) 249, 1000, 1871
Bst2UI CCWGG 2 cut(s) 1406, 1769
Bst4CI ACNGT 5 cut(s) 70, 96, 175, 429, 1853
Bst6I CTCTTC 1 cut(s) 762
BstACI GRCGYC 2 cut(s) 350, 1433
BstAPI GCANNNNNTGC 1 cut(s) 1492
BstBAI YACGTR 2 cut(s) 1269, 1906
BstC8I GCNNGC 3 cut(s) 635, 1497, 1681
BstDEI CTNAG 5 cut(s) 219, 435, 693, 1053, 1809
BstDSI CCRYGG 1 cut(s) 156
BstF5I GGATG 4 cut(s) 120, 202, 328, 1414
BstFNI CGCG 1 cut(s) 22
BstH2I RGCGCY 2 cut(s) 135, 1587
BstHHI GCGC 4 cut(s) 24, 134, 1227, 1586
BstKTI GATC 8 cut(s) 277, 400, 495, 511, 574, 688, 1084, 1201
BstMAI GTCTC 2 cut(s) 935, 1452
BstMBI GATC 8 cut(s) 274, 397, 492, 508, 571, 685, 1081, 1198
BstMCI CGRYCG 1 cut(s) 44
BstMWI GCNNNNNNNGC 7 cut(s) 412, 558, 862, 1140, 1384, 1492, 1793
BstNI CCWGG 2 cut(s) 1406, 1769
BstSCI CCNGG 5 cut(s) 268, 673, 1404, 1555, 1767
BstSFI CTRYAG 2 cut(s) 609, 1290
BstSLI GKGCMC 2 cut(s) 1100, 1858
BstUI CGCG 1 cut(s) 22
BstV2I GAAGAC 2 cut(s) 39, 267
BstXI CCANNNNNNTGG 2 cut(s) 563, 1405
BsuRI GGCC 3 cut(s) 310, 555, 1447
BtgI CCRYGG 1 cut(s) 156
BtsCI GGATG 4 cut(s) 120, 202, 328, 1414
BtsI GCAGTG 2 cut(s) 183, 498
BtsIMutI CAGTG 5 cut(s) 92, 183, 498, 1448, 1849
BveI ACCTGC 2 cut(s) 616, 1283
Cac8I GCNNGC 3 cut(s) 635, 1497, 1681
CaiI CAGNNNCTG 3 cut(s) 1079, 1298, 1816
CciI TCATGA 1 cut(s) 907
CfoI GCGC 4 cut(s) 24, 134, 1227, 1586
Cfr13I GGNCC 4 cut(s) 308, 1295, 1394, 1566
Csp6I GTAC 4 cut(s) 1264, 1481, 1619, 1806
CviAII CATG 6 cut(s) 908, 950, 1580, 1632, 1745, 1801
CviQI GTAC 4 cut(s) 1264, 1481, 1619, 1806
DdeI CTNAG 5 cut(s) 219, 435, 693, 1053, 1809
DpnI GATC 8 cut(s) 276, 399, 494, 510, 573, 687, 1083, 1200
DpnII GATC 8 cut(s) 274, 397, 492, 508, 571, 685, 1081, 1198
DraIII CACNNNGTG 1 cut(s) 98
DriI GACNNNNNGTC 1 cut(s) 1293
EaeI YGGCCR 2 cut(s) 553, 1445
Eam1104I CTCTTC 1 cut(s) 762
Eam1105I GACNNNNNGTC 1 cut(s) 1293
EarI CTCTTC 1 cut(s) 762
EciI GGCGGA 1 cut(s) 1514
Eco130I CCWWGG 3 cut(s) 249, 1000, 1871
Eco47I GGWCC 3 cut(s) 1295, 1394, 1566
Eco47III AGCGCT 1 cut(s) 133
Eco57I CTGAAG 1 cut(s) 402
Eco72I CACGTG 1 cut(s) 1269
Eco88I CYCGRG 3 cut(s) 1111, 1144, 1647
EcoO109I RGGNCCY 3 cut(s) 1295, 1394, 1566
EcoRII CCWGG 2 cut(s) 1404, 1767
EcoT14I CCWWGG 3 cut(s) 249, 1000, 1871
ErhI CCWWGG 3 cut(s) 249, 1000, 1871
FaeI CATG 6 cut(s) 911, 953, 1583, 1635, 1748, 1804
FaqI GGGAC 5 cut(s) 796, 1151, 1380, 1524, 1579
FatI CATG 6 cut(s) 907, 949, 1579, 1631, 1744, 1800
FauI CCCGC 1 cut(s) 1127
FbaI TGATCA 3 cut(s) 508, 571, 1081
FokI GGATG 4 cut(s) 127, 209, 335, 1401
FspBI CTAG 1 cut(s) 779
GlaI GCGC 4 cut(s) 23, 133, 1226, 1585
GsaI CCCAGC 1 cut(s) 1830
GsuI CTGGAG 2 cut(s) 112, 156
HaeII RGCGCY 2 cut(s) 135, 1587
HaeIII GGCC 3 cut(s) 310, 555, 1447
HapII CCGG 6 cut(s) 270, 281, 674, 1418, 1536, 1556
HhaI GCGC 4 cut(s) 24, 134, 1227, 1586
Hin1I GRCGYC 2 cut(s) 350, 1433
Hin1II CATG 6 cut(s) 911, 953, 1583, 1635, 1748, 1804
Hin6I GCGC 4 cut(s) 22, 132, 1225, 1584
HinP1I GCGC 4 cut(s) 22, 132, 1225, 1584
HindIII AAGCTT 1 cut(s) 654
HinfI GANTC 9 cut(s) 84, 809, 871, 1043, 1103, 1160, 1169, 1189, 1624
HpaII CCGG 6 cut(s) 270, 281, 674, 1418, 1536, 1556
HphI GGTGA 3 cut(s) 284, 1516, 1550
Hpy166II GTNNAC 3 cut(s) 1266, 1849, 1856
Hpy188I TCNGA 9 cut(s) 196, 322, 402, 436, 625, 696, 1155, 1207, 1812
Hpy8I GTNNAC 3 cut(s) 1266, 1849, 1856
Hpy99I CGWCG 1 cut(s) 941
HpyAV CCTTC 6 cut(s) 1210, 1321, 1501, 1616, 1831, 1877
HpyCH4III ACNGT 5 cut(s) 70, 96, 175, 429, 1853
HpyCH4IV ACGT 6 cut(s) 350, 1268, 1433, 1662, 1858, 1905
HpyF10VI GCNNNNNNNGC 7 cut(s) 412, 558, 862, 1140, 1384, 1492, 1793
HpyF3I CTNAG 5 cut(s) 219, 435, 693, 1053, 1809
HpySE526I ACGT 6 cut(s) 350, 1268, 1433, 1662, 1858, 1905
Hsp92I GRCGYC 2 cut(s) 350, 1433
Hsp92II CATG 6 cut(s) 911, 953, 1583, 1635, 1748, 1804
HspAI GCGC 4 cut(s) 22, 132, 1225, 1584
KflI GGGWCCC 2 cut(s) 1394, 1566
Kpn2I TCCGGA 2 cut(s) 280, 1417
Ksp22I TGATCA 3 cut(s) 508, 571, 1081
Kzo9I GATC 8 cut(s) 274, 397, 492, 508, 571, 685, 1081, 1198
LguI GCTCTTC 1 cut(s) 762
LmnI GCTCC 1 cut(s) 721
LweI GCATC 9 cut(s) 277, 313, 364, 687, 886, 913, 1263, 1375, 1831
MaeI CTAG 1 cut(s) 779
MaeII ACGT 6 cut(s) 350, 1268, 1433, 1662, 1858, 1905
MaeIII GTNAC 5 cut(s) 32, 175, 952, 1285, 1424
MalI GATC 8 cut(s) 276, 399, 494, 510, 573, 687, 1083, 1200
MbiI CCGCTC 1 cut(s) 561
MboI GATC 8 cut(s) 274, 397, 492, 508, 571, 685, 1081, 1198
MboII GAAGA 8 cut(s) 39, 269, 272, 395, 502, 779, 1052, 1186
MhlI GDGCHC 2 cut(s) 1100, 1858
MluCI AATT 5 cut(s) 121, 619, 799, 1571, 1900
MlyI GAGTC 5 cut(s) 818, 1112, 1169, 1178, 1183
MmeI TCCRAC 2 cut(s) 1131, 1185
MroI TCCGGA 2 cut(s) 280, 1417
MseI TTAA 2 cut(s) 417, 1527
MspA1I CMGCKG 3 cut(s) 218, 380, 1079
MspI CCGG 6 cut(s) 270, 281, 674, 1418, 1536, 1556
MspR9I CCNGG 5 cut(s) 270, 675, 1406, 1557, 1769
Mva1269I GAATGC 2 cut(s) 685, 1149
MvaI CCWGG 2 cut(s) 1406, 1769
MvnI CGCG 1 cut(s) 22
MwoI GCNNNNNNNGC 7 cut(s) 412, 558, 862, 1140, 1384, 1492, 1793
NciI CCSGG 3 cut(s) 270, 675, 1557
NdeII GATC 8 cut(s) 274, 397, 492, 508, 571, 685, 1081, 1198
NlaIII CATG 6 cut(s) 911, 953, 1583, 1635, 1748, 1804
NlaIV GGNNCC 7 cut(s) 1099, 1395, 1396, 1410, 1567, 1568, 1877
NmuCI GTSAC 3 cut(s) 175, 952, 1285
PaeR7I CTCGAG 1 cut(s) 1647
PagI TCATGA 1 cut(s) 907
PciSI GCTCTTC 1 cut(s) 762
PcsI WCGNNNNNNNCGW 2 cut(s) 1151, 1178
PctI GAATGC 2 cut(s) 685, 1149
PfeI GAWTC 4 cut(s) 84, 871, 1043, 1624
PleI GAGTC 5 cut(s) 817, 1111, 1168, 1177, 1183
PmaCI CACGTG 1 cut(s) 1269
PmlI CACGTG 1 cut(s) 1269
PpsI GAGTC 5 cut(s) 817, 1111, 1168, 1177, 1183
Ppu21I YACGTR 2 cut(s) 1269, 1906
PpuMI RGGWCCY 3 cut(s) 1295, 1394, 1566
Psp5II RGGWCCY 3 cut(s) 1295, 1394, 1566
Psp6I CCWGG 2 cut(s) 1404, 1767
PspCI CACGTG 1 cut(s) 1269
PspFI CCCAGC 1 cut(s) 1826
PspGI CCWGG 2 cut(s) 1404, 1767
PspN4I GGNNCC 7 cut(s) 1099, 1395, 1396, 1410, 1567, 1568, 1877
PspPI GGNCC 4 cut(s) 308, 1295, 1394, 1566
PspPPI RGGWCCY 3 cut(s) 1295, 1394, 1566
PspXI VCTCGAGB 1 cut(s) 1647
PstI CTGCAG 2 cut(s) 613, 1294
PstNI CAGNNNCTG 3 cut(s) 1079, 1298, 1816
PvuII CAGCTG 2 cut(s) 380, 1079
RsaI GTAC 4 cut(s) 1265, 1482, 1620, 1807
RsaNI GTAC 4 cut(s) 1264, 1481, 1619, 1806
SapI GCTCTTC 1 cut(s) 762
SaqAI TTAA 2 cut(s) 417, 1527
Sau3AI GATC 8 cut(s) 274, 397, 492, 508, 571, 685, 1081, 1198
Sau96I GGNCC 4 cut(s) 308, 1295, 1394, 1566
SchI GAGTC 5 cut(s) 818, 1112, 1169, 1178, 1183
ScrFI CCNGG 5 cut(s) 270, 675, 1406, 1557, 1769
SduI GDGCHC 2 cut(s) 1100, 1858
SfaNI GCATC 9 cut(s) 277, 313, 364, 687, 886, 913, 1263, 1375, 1831
SfcI CTRYAG 2 cut(s) 609, 1290
Sfr274I CTCGAG 1 cut(s) 1647
SinI GGWCC 3 cut(s) 1295, 1394, 1566
SlaI CTCGAG 1 cut(s) 1647
SmlI CTYRAG 5 cut(s) 597, 651, 1191, 1647, 1752
SmoI CTYRAG 5 cut(s) 597, 651, 1191, 1647, 1752
Sse9I AATT 5 cut(s) 121, 619, 799, 1571, 1900
SspI AATATT 1 cut(s) 823
SspMI CTAG 1 cut(s) 779
StyD4I CCNGG 5 cut(s) 268, 673, 1404, 1555, 1767
StyI CCWWGG 3 cut(s) 249, 1000, 1871
TaaI ACNGT 5 cut(s) 70, 96, 175, 429, 1853
TaiI ACGT 6 cut(s) 353, 1271, 1436, 1665, 1861, 1908
TaqI TCGA 5 cut(s) 163, 1172, 1369, 1648, 1881
TasI AATT 5 cut(s) 121, 619, 799, 1571, 1900
TauI GCSGC 2 cut(s) 218, 555
TfiI GAWTC 4 cut(s) 84, 871, 1043, 1624
Tru1I TTAA 2 cut(s) 417, 1527
Tru9I TTAA 2 cut(s) 417, 1527
TscAI CASTG 5 cut(s) 99, 190, 505, 1448, 1856
TseFI GTSAC 3 cut(s) 175, 952, 1285
Tsp45I GTSAC 3 cut(s) 175, 952, 1285
TspDTI ATGAA 7 cut(s) 76, 134, 213, 810, 999, 1564, 1761
TspRI CASTG 5 cut(s) 99, 190, 505, 1448, 1856
VneI GTGCAC 1 cut(s) 1854
VpaK11BI GGWCC 3 cut(s) 1295, 1394, 1566
XapI RAATTY 2 cut(s) 619, 799
XcmI CCANNNNNNNNNTGG 1 cut(s) 1577
XhoI CTCGAG 1 cut(s) 1647
XspI CTAG 1 cut(s) 779
ZraI GACGTC 2 cut(s) 351, 1434
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.