Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002547.1

Orthogroup ID

OG0011678

Physical Location & Seq

Genomic Coordinates Forward (+)

101798 .. 103266

Gene Structure 1469 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002547.1_g000022.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 858 bp

atgactgccttaacaaagtctatgtgttgggaccttattacgatcaagaacaacaaagtaaatttagttgccgctgccatctaccgcaagccaacctcgaaccaatgctacgaacaaagaaagcaaaagcaacctcctatgtgcaaaaccgatgatgatcccaatgctgcctggtatgtacctctgcaggcatgtatgcacagggttcctgttgacaaatctgagagagggactcaatggcctgagaactggcctaatcgactggaaactcctccttactggttaaacagctcccggatgggtatttatggaaaaccagcaccccaagattttgcaagagattatgaacactggaaacgtgtgatcaacaacagttacatgaaaagtttgggtatcaattggtccggagtcagaaatgtcatggatatgagagcggtttatggagggtttgccgccgctctcaaggatcttaaggtctgggtgatgaatgtggtgaatgtagattctgcagatactctccccatcatctatgaacgtggtctttttggaatttatcatgattggtgtgaatcttttagcacctacccaagaacctatgacctgctccatgcagatcatctcttttcttcgctcaaaaagaggtgcagacttcctccggtaatggcagaaattgatcggattgtcaggccgggaggcaaattgatcgtccgcgatgaatccagcgcaattggggaggttgagaacttgttgaagtccctgcattgggaggttcacttaaccttctccaaaaaccaagaagggatgcttagtgcacagaaaggcaattggcggccaaccacatcggcagatacttcttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Methyltransf_29

Protein Analysis

285

Amino Acids

32.8

Weight (kDa)

9.02

Isoelectric Point (pI)

29.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011678)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G51070 AT3G51070
fragaria_vesca	FvH4_1g12411
malus_domestica	MD02G1136800.v1.1 MD15G1250600.v1.1
prunus_persica	Prupe.7G163700_v2.0.a1
pyrus_communis	pycom15g22090
rosa_chinensis	RchiOBHm_Chr2g0100281
rosa_laevigata	RLG00000016952
rosa_multiflora	Rmu_sc0002547.1_g000021 Rmu_sc0002547.1_g000022
rosa_roxburghii	Rroxscaffold_2G00142420
rosa_rugosa	Rorug02G0087100 Rorug02G0087200
rosa_samantha	Rh2AG136100 Rh2BG139700 Rh2CG141400 Rh2DG141600
rosa_wichuraiana	Rw2G010650

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	609
AccBSI	CCGCTC	2 cut(s)	434, 458
AccII	CGCG	1 cut(s)	711
AccIII	TCCGGA	1 cut(s)	404
AciI	CCGC	7 cut(s)	72, 85, 434, 453, 456, 709, 829
AclWI	GGATC	2 cut(s)	152, 474
AcoI	YGGCCR	1 cut(s)	830
AcsI	RAATTY	2 cut(s)	61, 549
AfaI	GTAC	1 cut(s)	180
AfiI	CCNNNNNNNGG	2 cut(s)	762, 763
AflII	CTTAAG	1 cut(s)	470
AflIII	ACRYGT	1 cut(s)	358
AgsI	TTSAA	1 cut(s)	751
AjnI	CCWGG	1 cut(s)	170
AluBI	AGCT	1 cut(s)	291
AluI	AGCT	1 cut(s)	291
Alw21I	GWGCWC	1 cut(s)	814
Alw44I	GTGCAC	1 cut(s)	810
AlwI	GGATC	2 cut(s)	152, 474
Aor13HI	TCCGGA	1 cut(s)	404
AoxI	GGCC	4 cut(s)	239, 251, 686, 830
ApaLI	GTGCAC	1 cut(s)	810
ApeKI	GCWGC	2 cut(s)	74, 167
ApoI	RAATTY	2 cut(s)	61, 549
ArsI	GACNNNNNNTTYG	2 cut(s)	690, 722
AspLEI	GCGC	1 cut(s)	725
AspS9I	GGNCC	2 cut(s)	31, 402
AsuC2I	CCSGG	2 cut(s)	295, 690
AsuHPI	GGTGA	2 cut(s)	493, 505
AvaII	GGWCC	2 cut(s)	31, 402
BaeGI	GKGCMC	1 cut(s)	814
Bbv12I	GWGCWC	1 cut(s)	814
BbvI	GCAGC	2 cut(s)	61, 154
BccI	CCATC	3 cut(s)	86, 292, 530
BcgI	CGANNNNNNTGC	2 cut(s)	685, 719
BciT130I	CCWGG	1 cut(s)	172
BclI	TGATCA	1 cut(s)	363
BcnI	CCSGG	2 cut(s)	295, 690
BfmI	CTRYAG	2 cut(s)	185, 507
BfrI	CTTAAG	1 cut(s)	470
BfuAI	ACCTGC	1 cut(s)	609
BisI	GCNGC	6 cut(s)	72, 75, 168, 453, 456, 830
BlsI	GCNGC	6 cut(s)	73, 76, 169, 454, 457, 831
Bme1390I	CCNGG	3 cut(s)	172, 295, 690
Bme18I	GGWCC	2 cut(s)	31, 402
BmgT120I	GGNCC	2 cut(s)	31, 402
BmiI	GGNNCC	2 cut(s)	32, 207
BmrFI	CCNGG	3 cut(s)	172, 295, 690
BmsI	GCATC	1 cut(s)	792
BplI	GAGNNNNNCTC	2 cut(s)	217, 249
BpuEI	CTTGAG	1 cut(s)	446
BpuMI	CCSGG	2 cut(s)	295, 690
BsaBI	GATNNNNATC	1 cut(s)	156
BsaWI	WCCGGW	2 cut(s)	404, 655
Bsc4I	CCNNNNNNNGG	2 cut(s)	762, 763
Bse1I	ACTGG	4 cut(s)	254, 267, 284, 356
Bse8I	GATNNNNATC	1 cut(s)	156
BseAI	TCCGGA	1 cut(s)	404
BseBI	CCWGG	1 cut(s)	172
BseGI	GGATG	2 cut(s)	303, 807
BseJI	GATNNNNATC	1 cut(s)	156
BseLI	CCNNNNNNNGG	2 cut(s)	762, 763
BseMII	CTCAG	2 cut(s)	213, 234
BseNI	ACTGG	4 cut(s)	254, 267, 284, 356
BseRI	GAGGAG	1 cut(s)	261
BseSI	GKGCMC	1 cut(s)	814
BseXI	GCAGC	2 cut(s)	61, 154
BsgI	GTGCAG	1 cut(s)	664
Bsh1236I	CGCG	1 cut(s)	711
BshFI	GGCC	4 cut(s)	241, 253, 688, 832
BsiHKAI	GWGCWC	1 cut(s)	814
BsiSI	CCGG	4 cut(s)	295, 405, 656, 689
BslFI	GGGAC	3 cut(s)	44, 244, 739
BslI	CCNNNNNNNGG	2 cut(s)	762, 763
BsmFI	GGGAC	3 cut(s)	44, 244, 739
BsnI	GGCC	4 cut(s)	241, 253, 688, 832
Bsp1286I	GDGCHC	1 cut(s)	814
Bsp13I	TCCGGA	1 cut(s)	404
Bsp143I	GATC	7 cut(s)	42, 157, 363, 466, 613, 673, 702
BspACI	CCGC	7 cut(s)	72, 85, 434, 453, 456, 709, 829
BspANI	GGCC	4 cut(s)	241, 253, 688, 832
BspCNI	CTCAG	2 cut(s)	214, 235
BspEI	TCCGGA	1 cut(s)	404
BspFNI	CGCG	1 cut(s)	711
BspHI	TCATGA	1 cut(s)	556
BspLI	GGNNCC	2 cut(s)	32, 207
BspMAI	CTGCAG	2 cut(s)	189, 511
BspMI	ACCTGC	1 cut(s)	609
BspPI	GGATC	2 cut(s)	152, 474
BspTI	CTTAAG	1 cut(s)	470
BsrBI	CCGCTC	2 cut(s)	434, 458
BsrI	ACTGG	4 cut(s)	254, 267, 284, 356
BssMI	GATC	7 cut(s)	42, 157, 363, 466, 613, 673, 702
Bst2UI	CCWGG	1 cut(s)	172
Bst4CI	ACNGT	1 cut(s)	374
BstAFI	CTTAAG	1 cut(s)	470
BstC8I	GCNNGC	2 cut(s)	89, 189
BstDEI	CTNAG	3 cut(s)	222, 243, 806
BstF5I	GGATG	2 cut(s)	303, 807
BstFNI	CGCG	1 cut(s)	711
BstHHI	GCGC	1 cut(s)	725
BstKTI	GATC	7 cut(s)	45, 160, 366, 469, 616, 676, 705
BstMBI	GATC	7 cut(s)	42, 157, 363, 466, 613, 673, 702
BstNI	CCWGG	1 cut(s)	172
BstNSI	RCATGY	1 cut(s)	195
BstSCI	CCNGG	3 cut(s)	170, 293, 688
BstSFI	CTRYAG	2 cut(s)	185, 507
BstSLI	GKGCMC	1 cut(s)	814
BstUI	CGCG	1 cut(s)	711
BstV1I	GCAGC	2 cut(s)	61, 154
BstX2I	RGATCY	1 cut(s)	466
BstYI	RGATCY	1 cut(s)	466
BsuRI	GGCC	4 cut(s)	241, 253, 688, 832
BtgZI	GCGATG	1 cut(s)	726
BtsCI	GGATG	2 cut(s)	303, 807
BtsIMutI	CAGTG	1 cut(s)	349
BveI	ACCTGC	1 cut(s)	609
Cac8I	GCNNGC	2 cut(s)	89, 189
CciI	TCATGA	1 cut(s)	556
CfoI	GCGC	1 cut(s)	725
Cfr13I	GGNCC	2 cut(s)	31, 402
Csp6I	GTAC	1 cut(s)	179
CviAII	CATG	5 cut(s)	192, 379, 421, 557, 608
CviJI	RGCY	6 cut(s)	91, 241, 253, 291, 688, 832
CviKI_1	RGCY	6 cut(s)	91, 241, 253, 291, 688, 832
CviQI	GTAC	1 cut(s)	179
DdeI	CTNAG	3 cut(s)	222, 243, 806
DpnI	GATC	7 cut(s)	44, 159, 365, 468, 615, 675, 704
DpnII	GATC	7 cut(s)	42, 157, 363, 466, 613, 673, 702
EaeI	YGGCCR	1 cut(s)	830
Eco47I	GGWCC	2 cut(s)	31, 402
EcoO109I	RGGNCCY	1 cut(s)	31
EcoRII	CCWGG	1 cut(s)	170
FaeI	CATG	5 cut(s)	195, 382, 424, 560, 611
FalI	AAGNNNNNCTT	2 cut(s)	789, 821
FaqI	GGGAC	3 cut(s)	44, 244, 739
FatI	CATG	5 cut(s)	191, 378, 420, 556, 607
FbaI	TGATCA	1 cut(s)	363
Fnu4HI	GCNGC	6 cut(s)	72, 75, 168, 453, 456, 830
FokI	GGATG	2 cut(s)	310, 814
Fsp4HI	GCNGC	6 cut(s)	72, 75, 168, 453, 456, 830
GlaI	GCGC	1 cut(s)	724
GluI	GCNGC	6 cut(s)	72, 75, 168, 453, 456, 830
HaeIII	GGCC	4 cut(s)	241, 253, 688, 832
HapII	CCGG	4 cut(s)	295, 405, 656, 689
HhaI	GCGC	1 cut(s)	725
Hin1II	CATG	5 cut(s)	195, 382, 424, 560, 611
Hin6I	GCGC	1 cut(s)	723
HinP1I	GCGC	1 cut(s)	723
HincII	GTYRAC	1 cut(s)	214
HindII	GTYRAC	1 cut(s)	214
HinfI	GANTC	5 cut(s)	232, 408, 503, 569, 716
HpaII	CCGG	4 cut(s)	295, 405, 656, 689
HphI	GGTGA	2 cut(s)	493, 505
Hpy166II	GTNNAC	3 cut(s)	214, 772, 812
Hpy188I	TCNGA	3 cut(s)	223, 413, 678
Hpy188III	TCNNGA	3 cut(s)	46, 405, 557
Hpy8I	GTNNAC	3 cut(s)	214, 772, 812
HpyAV	CCTTC	2 cut(s)	790, 791
HpyCH4III	ACNGT	1 cut(s)	374
HpyCH4IV	ACGT	2 cut(s)	358, 535
HpyCH4V	TGCA	9 cut(s)	144, 187, 199, 335, 509, 611, 645, 760, 812
HpyF3I	CTNAG	3 cut(s)	222, 243, 806
HpySE526I	ACGT	2 cut(s)	358, 535
Hsp92II	CATG	5 cut(s)	195, 382, 424, 560, 611
HspAI	GCGC	1 cut(s)	723
Kpn2I	TCCGGA	1 cut(s)	404
Ksp22I	TGATCA	1 cut(s)	363
Kzo9I	GATC	7 cut(s)	42, 157, 363, 466, 613, 673, 702
LmnI	GCTCC	2 cut(s)	296, 609
Lsp1109I	GCAGC	2 cut(s)	61, 154
LweI	GCATC	1 cut(s)	792
MaeII	ACGT	2 cut(s)	358, 535
MaeIII	GTNAC	1 cut(s)	374
MalI	GATC	7 cut(s)	44, 159, 365, 468, 615, 675, 704
MbiI	CCGCTC	2 cut(s)	434, 458
MboI	GATC	7 cut(s)	42, 157, 363, 466, 613, 673, 702
MboII	GAAGA	1 cut(s)	618
MfeI	CAATTG	3 cut(s)	397, 726, 823
MflI	RGATCY	1 cut(s)	466
MhlI	GDGCHC	1 cut(s)	814
MluCI	AATT	7 cut(s)	61, 397, 549, 669, 698, 726, 823
MlyI	GAGTC	2 cut(s)	226, 417
MroI	TCCGGA	1 cut(s)	404
MseI	TTAA	5 cut(s)	11, 284, 471, 776, 856
MslI	CAYNNNNRTG	1 cut(s)	425
MspA1I	CMGCKG	1 cut(s)	74
MspCI	CTTAAG	1 cut(s)	470
MspI	CCGG	4 cut(s)	295, 405, 656, 689
MspR9I	CCNGG	3 cut(s)	172, 295, 690
MunI	CAATTG	3 cut(s)	397, 726, 823
MvaI	CCWGG	1 cut(s)	172
MvnI	CGCG	1 cut(s)	711
NciI	CCSGG	2 cut(s)	295, 690
NdeII	GATC	7 cut(s)	42, 157, 363, 466, 613, 673, 702
NlaIII	CATG	5 cut(s)	195, 382, 424, 560, 611
NlaIV	GGNNCC	2 cut(s)	32, 207
NspI	RCATGY	1 cut(s)	195
PagI	TCATGA	1 cut(s)	556
PfeI	GAWTC	3 cut(s)	503, 569, 716
PfoI	TCCNGGA	1 cut(s)	293
PkrI	GCNGC	6 cut(s)	73, 76, 169, 454, 457, 831
PleI	GAGTC	2 cut(s)	226, 416
PpsI	GAGTC	2 cut(s)	226, 416
PpuMI	RGGWCCY	1 cut(s)	31
Psp5II	RGGWCCY	1 cut(s)	31
Psp6I	CCWGG	1 cut(s)	170
PspGI	CCWGG	1 cut(s)	170
PspN4I	GGNNCC	2 cut(s)	32, 207
PspPI	GGNCC	2 cut(s)	31, 402
PspPPI	RGGWCCY	1 cut(s)	31
PsrI	GAACNNNNNNTAC	2 cut(s)	92, 124
PstI	CTGCAG	2 cut(s)	189, 511
PsuI	RGATCY	1 cut(s)	466
RsaI	GTAC	1 cut(s)	180
RsaNI	GTAC	1 cut(s)	179
RseI	CAYNNNNRTG	1 cut(s)	425
SaqAI	TTAA	5 cut(s)	11, 284, 471, 776, 856
SatI	GCNGC	6 cut(s)	72, 75, 168, 453, 456, 830
Sau3AI	GATC	7 cut(s)	42, 157, 363, 466, 613, 673, 702
Sau96I	GGNCC	2 cut(s)	31, 402
SchI	GAGTC	2 cut(s)	226, 417
ScrFI	CCNGG	3 cut(s)	172, 295, 690
SduI	GDGCHC	1 cut(s)	814
SfaNI	GCATC	1 cut(s)	792
SfcI	CTRYAG	2 cut(s)	185, 507
SinI	GGWCC	2 cut(s)	31, 402
SmiMI	CAYNNNNRTG	1 cut(s)	425
SmlI	CTYRAG	2 cut(s)	461, 470
SmoI	CTYRAG	2 cut(s)	461, 470
Sse9I	AATT	7 cut(s)	61, 397, 549, 669, 698, 726, 823
SsiI	CCGC	7 cut(s)	72, 85, 434, 453, 456, 709, 829
StyD4I	CCNGG	3 cut(s)	170, 293, 688
TaaI	ACNGT	1 cut(s)	374
TaiI	ACGT	2 cut(s)	361, 538
TaqI	TCGA	2 cut(s)	98, 259
TasI	AATT	7 cut(s)	61, 397, 549, 669, 698, 726, 823
TauI	GCSGC	4 cut(s)	74, 455, 458, 832
TfiI	GAWTC	3 cut(s)	503, 569, 716
Tru1I	TTAA	5 cut(s)	11, 284, 471, 776, 856
Tru9I	TTAA	5 cut(s)	11, 284, 471, 776, 856
TscAI	CASTG	1 cut(s)	356
TseI	GCWGC	2 cut(s)	74, 167
TspDTI	ATGAA	5 cut(s)	360, 395, 500, 546, 729
TspRI	CASTG	1 cut(s)	356
Vha464I	CTTAAG	1 cut(s)	470
VneI	GTGCAC	1 cut(s)	810
VpaK11BI	GGWCC	2 cut(s)	31, 402
XapI	RAATTY	2 cut(s)	61, 549
XceI	RCATGY	1 cut(s)	195

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.