Rmu_sc0002614.1_g000003

ATP synthase regulation protein NCA2

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002614.1
Physical Location & Seq
Forward (+)
10348 .. 12679
2332 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002614.1_g000003.1.cds

Sequence Viewer

Length: 1791 bp
atggaggtcagtccagcttcaccgacggaggtaaacgaaaccaaagacctcaaaaccctaatctccttctactcccactacctctggaaccgactcctcgatctcctcccctcttccgattacaattttctccgcagaatccgagtccgagccgccgcatcacggcggagacaccgcgcatgtcttccgctcccttttccggctaatatactcgactcttgccagccggcgacgacggaggcgtctagagttctcgatgttctacatgagattctgaagcacaccttctccaatttgcaccatgtccagaagaacctgcagttttgggagtctagggctgagggatcaaaagctcaaaaagttaagtttatggtgcttcagagaggtccgcaggcttttgttgatggtacaatccaactgatatgtggatatgatggtgagggttcttccatacagaatatgtgccgctctgcatcggcttacatgtctgagaggatagcagtattaagtagcttaagatcttctcttgccacatttttggcccagttttacatggaaattgaaagattcggagaagagttggtgaaagatccagggagttcattgccctccttattagagagaattaatgacttgttcttcgaattagaggcgtctatcggccatctccatgcaatgcgcccgagtgattcttctgttgaaggaagctattcatttcccctagtatttgagaaattgcccgagataaatcaagacagatcccagtggacagactgtgaaattagggattcaatcaatttgatttctcaaaatttggagaaactggaatctcacttaacttttatagttgacaaacatcggaaaccaaggagggtaactcgatattggatcccctatacttgtggtgcggttggcctctcagtttgttctgtgtggctcataagacatagtcgtctgtcaggaagtcatgacatagataattgggttagagaagctaaggattcaaccgtcagcttcttgcgtgatcatgttgagcaaccgctgctgtctattagagatgaactttttaagacattcaggcaaaggcacaaaggaatgatggagcttgaagaagtgcaattaacctccaattctctgcacagaatgttgttggctttcagtgagcagacaaaagggcaaaatttcccagagaatgcatctgatcaggaaatgcttgaaatagttatggctaggtatgaaaaggaacttgaacatcctattcataaccttgtaaatggcgagctggctcgtgccttgctgatccaggttcagaagctaaaactcgatactgaaaccgccatgcttgaattgaaccagattctgagggcaaatgagataaactttgcaatcctagctgctttaccagcattctttctctccctcattctgctaatgctagtgcgtgcatggttcaaacgggataaaagagcagaaggaaggggacgagttgctcggctccagaggaggttacttgttgtggaagttgagaagaggattatgcagtatcaaagttttatcgatcaagggatggagaaagaagcgctagacatgttcggattgttgttgtatagtctggatcgcctataccatgctgtcaaggggcatgcaaaagcaactggggaatggcagtggttgtgtcaggatatagttgacctggcaaagcccagccttcaaactgcatttaaactcagagtgacctcgcggttggaacgggtttatgactgtttacttcctgcattgcagcgccagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

596

Amino Acids

68.8

Weight (kDa)

8.02

Isoelectric Point (pI)

49.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011465)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 241, 951
Acc36I ACCTGC 1 cut(s) 324
AccBSI CCGCTC 2 cut(s) 190, 468
AccII CGCG 2 cut(s) 177, 1741
AclWI GGATC 7 cut(s) 352, 584, 753, 883, 896, 1294, 1623
AcoI YGGCCR 1 cut(s) 661
AcsI RAATTY 2 cut(s) 811, 1180
AcuI CTGAAG 2 cut(s) 296, 362
AcyI GRCGYC 2 cut(s) 242, 653
AfaI GTAC 1 cut(s) 409
AfeI AGCGCT 1 cut(s) 1581
AfiI CCNNNNNNNGG 2 cut(s) 162, 199
AflII CTTAAG 1 cut(s) 514
AflIII ACRYGT 2 cut(s) 483, 1587
AjnI CCWGG 3 cut(s) 592, 1302, 1692
Alw26I GTCTC 1 cut(s) 163
AlwI GGATC 7 cut(s) 352, 584, 753, 883, 896, 1294, 1623
AlwNI CAGNNNCTG 1 cut(s) 1360
Ama87I CYCGRG 2 cut(s) 682, 740
Aor51HI AGCGCT 1 cut(s) 1581
AoxI GGCC 3 cut(s) 540, 661, 913
ApeKI GCWGC 3 cut(s) 1042, 1394, 1780
ApoI RAATTY 2 cut(s) 811, 1180
ArsI GACNNNNNNTTYG 2 cut(s) 623, 655
AseI ATTAAT 1 cut(s) 627
Asp700I GAANNNNTTC 1 cut(s) 709
AspLEI GCGC 4 cut(s) 179, 681, 1582, 1785
AspS9I GGNCC 2 cut(s) 386, 541
AsuHPI GGTGA 3 cut(s) 12, 449, 595
AsuII TTCGAA 1 cut(s) 642
AvaI CYCGRG 2 cut(s) 682, 740
AvaII GGWCC 1 cut(s) 386
BamHI GGATCC 1 cut(s) 888
BauI CACGAG 1 cut(s) 1287
BbsI GAAGAC 1 cut(s) 176
BbvCI CCTCAGC 1 cut(s) 339
BbvI GCAGC 2 cut(s) 1029, 1381
BccI CCATC 5 cut(s) 398, 428, 672, 1093, 1561
BceAI ACGGC 1 cut(s) 179
BciT130I CCWGG 3 cut(s) 594, 1304, 1694
BclI TGATCA 2 cut(s) 1024, 1201
BcoDI GTCTC 1 cut(s) 163
BfaI CTAG 7 cut(s) 246, 333, 722, 1230, 1391, 1436, 1583
BfmI CTRYAG 1 cut(s) 317
BfoI RGCGCY 2 cut(s) 1583, 1786
BfrI CTTAAG 1 cut(s) 514
BfuAI ACCTGC 1 cut(s) 324
BglII AGATCT 1 cut(s) 518
BisI GCNGC 6 cut(s) 153, 156, 466, 1043, 1395, 1781
BlsI GCNGC 6 cut(s) 154, 157, 467, 1044, 1396, 1782
Bme1390I CCNGG 3 cut(s) 594, 1304, 1694
Bme18I GGWCC 1 cut(s) 386
BmeT110I CYCGRG 2 cut(s) 682, 740
BmgT120I GGNCC 2 cut(s) 386, 541
BmiI GGNNCC 3 cut(s) 89, 890, 1496
BmrFI CCNGG 3 cut(s) 594, 1304, 1694
BmrI ACTGGG 3 cut(s) 538, 757, 1665
BmsI GCATC 3 cut(s) 167, 482, 1205
BmuI ACTGGG 3 cut(s) 538, 757, 1665
BpiI GAAGAC 1 cut(s) 176
BplI GAGNNNNNCTC 2 cut(s) 862, 894
BpmI CTGGAG 1 cut(s) 1481
Bpu10I CCTNAGC 2 cut(s) 339, 996
Bpu14I TTCGAA 1 cut(s) 642
Bsa29I ATCGAT 1 cut(s) 1557
BsaHI GRCGYC 2 cut(s) 242, 653
BsaJI CCNNGG 2 cut(s) 593, 866
BsaXI ACNNNNNCTCC 2 cut(s) 272, 302
Bsc4I CCNNNNNNNGG 2 cut(s) 162, 199
Bse118I RCCGGY 1 cut(s) 226
Bse1I ACTGG 5 cut(s) 544, 763, 828, 1660, 1786
Bse3DI GCAATG 3 cut(s) 602, 681, 1775
BseBI CCWGG 3 cut(s) 594, 1304, 1694
BseCI ATCGAT 1 cut(s) 1557
BseDI CCNNGG 2 cut(s) 593, 866
BseGI GGATG 2 cut(s) 1252, 1572
BseLI CCNNNNNNNGG 2 cut(s) 162, 199
BseMI GCAATG 3 cut(s) 602, 681, 1775
BseMII CTCAG 5 cut(s) 330, 480, 933, 1352, 1741
BseNI ACTGG 5 cut(s) 544, 763, 828, 1660, 1786
BseRI GAGGAG 3 cut(s) 86, 95, 1516
BseXI GCAGC 2 cut(s) 1029, 1381
BseYI CCCAGC 1 cut(s) 1703
BsgI GTGCAG 1 cut(s) 1121
Bsh1236I CGCG 2 cut(s) 177, 1741
BshFI GGCC 3 cut(s) 542, 663, 915
BshVI ATCGAT 1 cut(s) 1557
BsiHKCI CYCGRG 2 cut(s) 682, 740
BsiSI CCGG 2 cut(s) 200, 227
BslFI GGGAC 1 cut(s) 1494
BslI CCNNNNNNNGG 2 cut(s) 162, 199
BsmAI GTCTC 1 cut(s) 163
BsmFI GGGAC 1 cut(s) 1494
BsmI GAATGC 2 cut(s) 1198, 1406
BsnI GGCC 3 cut(s) 542, 663, 915
BsoBI CYCGRG 2 cut(s) 682, 740
Bsp119I TTCGAA 1 cut(s) 642
BspANI GGCC 3 cut(s) 542, 663, 915
BspCNI CTCAG 5 cut(s) 331, 481, 932, 1353, 1740
BspDI ATCGAT 1 cut(s) 1557
BspFNI CGCG 2 cut(s) 177, 1741
BspHI TCATGA 1 cut(s) 967
BspLI GGNNCC 3 cut(s) 89, 890, 1496
BspMAI CTGCAG 1 cut(s) 321
BspMI ACCTGC 1 cut(s) 324
BspPI GGATC 7 cut(s) 352, 584, 753, 883, 896, 1294, 1623
BspT104I TTCGAA 1 cut(s) 642
BspTI CTTAAG 1 cut(s) 514
BsrBI CCGCTC 2 cut(s) 190, 468
BsrDI GCAATG 3 cut(s) 602, 681, 1775
BsrFI RCCGGY 1 cut(s) 226
BsrI ACTGG 5 cut(s) 544, 763, 828, 1660, 1786
BssAI RCCGGY 1 cut(s) 226
BssECI CCNNGG 2 cut(s) 593, 866
BssNI GRCGYC 2 cut(s) 242, 653
BssSI CACGAG 1 cut(s) 1287
BssT1I CCWWGG 1 cut(s) 866
Bst2BI CACGAG 1 cut(s) 1287
Bst2UI CCWGG 3 cut(s) 594, 1304, 1694
Bst4CI ACNGT 3 cut(s) 776, 1009, 1763
Bst6I CTCTTC 3 cut(s) 118, 570, 1523
BstACI GRCGYC 2 cut(s) 242, 653
BstAFI CTTAAG 1 cut(s) 514
BstAPI GCANNNNNTGC 1 cut(s) 1042
BstBI TTCGAA 1 cut(s) 642
BstC8I GCNNGC 7 cut(s) 224, 228, 393, 1280, 1284, 1443, 1644
BstDEI CTNAG 6 cut(s) 339, 489, 919, 996, 1361, 1727
BstF5I GGATG 2 cut(s) 1252, 1572
BstFNI CGCG 2 cut(s) 177, 1741
BstH2I RGCGCY 2 cut(s) 1583, 1786
BstHHI GCGC 4 cut(s) 179, 681, 1582, 1785
BstMAI GTCTC 1 cut(s) 163
BstMWI GCNNNNNNNGC 3 cut(s) 1042, 1391, 1403
BstNI CCWGG 3 cut(s) 594, 1304, 1694
BstNSI RCATGY 4 cut(s) 183, 487, 1591, 1646
BstSCI CCNGG 3 cut(s) 592, 1302, 1692
BstSFI CTRYAG 1 cut(s) 317
BstUI CGCG 2 cut(s) 177, 1741
BstV1I GCAGC 2 cut(s) 1029, 1381
BstV2I GAAGAC 1 cut(s) 176
BstX2I RGATCY 4 cut(s) 518, 589, 758, 888
BstXI CCANNNNNNTGG 1 cut(s) 538
BstYI RGATCY 4 cut(s) 518, 589, 758, 888
Bsu15I ATCGAT 1 cut(s) 1557
BsuRI GGCC 3 cut(s) 542, 663, 915
BsuTUI ATCGAT 1 cut(s) 1557
BtsCI GGATG 2 cut(s) 1252, 1572
BtsI GCAGTG 1 cut(s) 1673
BtsIMutI CAGTG 3 cut(s) 770, 1165, 1673
BveI ACCTGC 1 cut(s) 324
Cac8I GCNNGC 7 cut(s) 224, 228, 393, 1280, 1284, 1443, 1644
CaiI CAGNNNCTG 1 cut(s) 1360
CciI TCATGA 1 cut(s) 967
CfoI GCGC 4 cut(s) 179, 681, 1582, 1785
Cfr10I RCCGGY 1 cut(s) 226
Cfr13I GGNCC 2 cut(s) 386, 541
ClaI ATCGAT 1 cut(s) 1557
CseI GACGC 2 cut(s) 231, 642
Csp6I GTAC 1 cut(s) 408
CviQI GTAC 1 cut(s) 408
DdeI CTNAG 6 cut(s) 339, 489, 919, 996, 1361, 1727
DraI TTTAAA 1 cut(s) 1723
DrdI GACNNNNNNGTC 2 cut(s) 241, 951
DseDI GACNNNNNNGTC 2 cut(s) 241, 951
EaeI YGGCCR 1 cut(s) 661
Eam1104I CTCTTC 3 cut(s) 118, 570, 1523
EarI CTCTTC 3 cut(s) 118, 570, 1523
EciI GGCGGA 1 cut(s) 181
Eco130I CCWWGG 1 cut(s) 866
Eco47I GGWCC 1 cut(s) 386
Eco47III AGCGCT 1 cut(s) 1581
Eco57I CTGAAG 2 cut(s) 296, 362
Eco88I CYCGRG 2 cut(s) 682, 740
EcoRII CCWGG 3 cut(s) 592, 1302, 1692
EcoT14I CCWWGG 1 cut(s) 866
EcoT22I ATGCAT 1 cut(s) 1198
ErhI CCWWGG 1 cut(s) 866
FalI AAGNNNNNCTT 2 cut(s) 269, 301
FaqI GGGAC 1 cut(s) 1494
FbaI TGATCA 2 cut(s) 1024, 1201
Fnu4HI GCNGC 6 cut(s) 153, 156, 466, 1043, 1395, 1781
FokI GGATG 2 cut(s) 1239, 1579
Fsp4HI GCNGC 6 cut(s) 153, 156, 466, 1043, 1395, 1781
FspBI CTAG 7 cut(s) 246, 333, 722, 1230, 1391, 1436, 1583
GlaI GCGC 4 cut(s) 178, 680, 1581, 1784
GluI GCNGC 6 cut(s) 153, 156, 466, 1043, 1395, 1781
GsaI CCCAGC 1 cut(s) 1707
GsuI CTGGAG 1 cut(s) 1481
HaeII RGCGCY 2 cut(s) 1583, 1786
HaeIII GGCC 3 cut(s) 542, 663, 915
HapII CCGG 2 cut(s) 200, 227
HgaI GACGC 2 cut(s) 231, 642
HhaI GCGC 4 cut(s) 179, 681, 1582, 1785
Hin1I GRCGYC 2 cut(s) 242, 653
Hin6I GCGC 4 cut(s) 177, 679, 1580, 1783
HinP1I GCGC 4 cut(s) 177, 679, 1580, 1783
HincII GTYRAC 2 cut(s) 850, 1690
HindII GTYRAC 2 cut(s) 850, 1690
HpaII CCGG 2 cut(s) 200, 227
HphI GGTGA 3 cut(s) 12, 449, 595
Hpy166II GTNNAC 5 cut(s) 34, 768, 850, 1690, 1766
Hpy8I GTNNAC 5 cut(s) 34, 768, 850, 1690, 1766
Hpy99I CGWCG 3 cut(s) 28, 235, 238
HpyAV CCTTC 6 cut(s) 76, 295, 695, 1466, 1470, 1718
HpyCH4III ACNGT 3 cut(s) 776, 1009, 1763
HpyF10VI GCNNNNNNNGC 3 cut(s) 1042, 1391, 1403
HpyF3I CTNAG 6 cut(s) 339, 489, 919, 996, 1361, 1727
Hsp92I GRCGYC 2 cut(s) 242, 653
HspAI GCGC 4 cut(s) 177, 679, 1580, 1783
KroI GCCGGC 1 cut(s) 226
KroNI GCCGGC 1 cut(s) 228
Ksp22I TGATCA 2 cut(s) 1024, 1201
LmnI GCTCC 3 cut(s) 195, 1102, 1500
Lsp1109I GCAGC 2 cut(s) 1029, 1381
LweI GCATC 3 cut(s) 167, 482, 1205
MaeI CTAG 7 cut(s) 246, 333, 722, 1230, 1391, 1436, 1583
MaeIII GTNAC 3 cut(s) 874, 1506, 1732
MbiI CCGCTC 2 cut(s) 190, 468
MflI RGATCY 4 cut(s) 518, 589, 758, 888
MlyI GAGTC 4 cut(s) 87, 153, 209, 338
MmeI TCCRAC 2 cut(s) 439, 1725
Mph1103I ATGCAT 1 cut(s) 1198
MroNI GCCGGC 1 cut(s) 226
MroXI GAANNNNTTC 1 cut(s) 709
MseI TTAA 8 cut(s) 363, 506, 515, 627, 836, 1068, 1121, 1722
MslI CAYNNNNRTG 1 cut(s) 669
MspA1I CMGCKG 1 cut(s) 1042
MspCI CTTAAG 1 cut(s) 514
MspI CCGG 2 cut(s) 200, 227
MspR9I CCNGG 3 cut(s) 594, 1304, 1694
Mva1269I GAATGC 2 cut(s) 1198, 1406
MvaI CCWGG 3 cut(s) 594, 1304, 1694
MvnI CGCG 2 cut(s) 177, 1741
MwoI GCNNNNNNNGC 3 cut(s) 1042, 1391, 1403
NaeI GCCGGC 1 cut(s) 228
NgoMIV GCCGGC 1 cut(s) 226
NlaIV GGNNCC 3 cut(s) 89, 890, 1496
NmeAIII GCCGAG 1 cut(s) 1471
NmuCI GTSAC 1 cut(s) 1732
NsiI ATGCAT 1 cut(s) 1198
NspI RCATGY 4 cut(s) 183, 487, 1591, 1646
NspV TTCGAA 1 cut(s) 642
PaeI GCATGC 1 cut(s) 1646
PagI TCATGA 1 cut(s) 967
PciI ACATGT 2 cut(s) 483, 1587
PcsI WCGNNNNNNNCGW 1 cut(s) 239
PctI GAATGC 2 cut(s) 1198, 1406
PdiI GCCGGC 1 cut(s) 228
PdmI GAANNNNTTC 1 cut(s) 709
PfeI GAWTC 8 cut(s) 138, 271, 567, 689, 788, 827, 1001, 1357
PflFI GACNNNGTC 1 cut(s) 948
PkrI GCNGC 6 cut(s) 154, 157, 467, 1044, 1396, 1782
PleI GAGTC 4 cut(s) 87, 152, 209, 337
PpsI GAGTC 4 cut(s) 87, 152, 209, 337
PscI ACATGT 2 cut(s) 483, 1587
PshBI ATTAAT 1 cut(s) 627
Psp6I CCWGG 3 cut(s) 592, 1302, 1692
PspFI CCCAGC 1 cut(s) 1703
PspGI CCWGG 3 cut(s) 592, 1302, 1692
PspN4I GGNNCC 3 cut(s) 89, 890, 1496
PspPI GGNCC 2 cut(s) 386, 541
PstI CTGCAG 1 cut(s) 321
PstNI CAGNNNCTG 1 cut(s) 1360
PsuI RGATCY 4 cut(s) 518, 589, 758, 888
PsyI GACNNNGTC 1 cut(s) 948
RsaI GTAC 1 cut(s) 409
RsaNI GTAC 1 cut(s) 408
RseI CAYNNNNRTG 1 cut(s) 669
SaqAI TTAA 8 cut(s) 363, 506, 515, 627, 836, 1068, 1121, 1722
SatI GCNGC 6 cut(s) 153, 156, 466, 1043, 1395, 1781
Sau96I GGNCC 2 cut(s) 386, 541
SchI GAGTC 4 cut(s) 87, 153, 209, 338
ScrFI CCNGG 3 cut(s) 594, 1304, 1694
SfaNI GCATC 3 cut(s) 167, 482, 1205
SfcI CTRYAG 1 cut(s) 317
SfuI TTCGAA 1 cut(s) 642
SinI GGWCC 1 cut(s) 386
SmiMI CAYNNNNRTG 1 cut(s) 669
SmlI CTYRAG 1 cut(s) 514
SmoI CTYRAG 1 cut(s) 514
SphI GCATGC 1 cut(s) 1646
SspMI CTAG 7 cut(s) 246, 333, 722, 1230, 1391, 1436, 1583
StyD4I CCNGG 3 cut(s) 592, 1302, 1692
StyI CCWWGG 1 cut(s) 866
TaaI ACNGT 3 cut(s) 776, 1009, 1763
TaqI TCGA 7 cut(s) 99, 213, 255, 642, 880, 1323, 1557
TauI GCSGC 3 cut(s) 155, 158, 468
TfiI GAWTC 8 cut(s) 138, 271, 567, 689, 788, 827, 1001, 1357
Tru1I TTAA 8 cut(s) 363, 506, 515, 627, 836, 1068, 1121, 1722
Tru9I TTAA 8 cut(s) 363, 506, 515, 627, 836, 1068, 1121, 1722
TscAI CASTG 3 cut(s) 770, 1165, 1673
TseFI GTSAC 1 cut(s) 1732
TseI GCWGC 3 cut(s) 1042, 1394, 1780
Tsp45I GTSAC 1 cut(s) 1732
TspDTI ATGAA 5 cut(s) 591, 702, 1074, 1250, 1251
TspGWI ACGGA 2 cut(s) 41, 251
TspRI CASTG 3 cut(s) 770, 1165, 1673
Tth111I GACNNNGTC 1 cut(s) 948
Vha464I CTTAAG 1 cut(s) 514
VpaK11BI GGWCC 1 cut(s) 386
VspI ATTAAT 1 cut(s) 627
XapI RAATTY 2 cut(s) 811, 1180
XbaI TCTAGA 1 cut(s) 245
XceI RCATGY 4 cut(s) 183, 487, 1591, 1646
XcmI CCANNNNNNNNNTGG 1 cut(s) 422
XmnI GAANNNNTTC 1 cut(s) 709
XspI CTAG 7 cut(s) 246, 333, 722, 1230, 1391, 1436, 1583
Zsp2I ATGCAT 1 cut(s) 1198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.