Rmu_sc0029194.1_g000001

ATP synthase regulation protein NCA2

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0029194.1
OG0011465
Physical Location & Seq
Reverse (-)
2062 .. 3534
1473 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0029194.1_g000001.1.cds

Sequence Viewer

Length: 1473 bp
atgtttgacatttgtcaatttcagggatcaaaagctcaaaaagttaagtttatggtgcttcagagaggtccgcaggcttttgttgatggtacaatccaactgatatgtggatatgatggtgagggttcttccatacagaatatgtgccgctctgcatcggcttacatgtctgagaggatagcagtattaattagcttaagatcttctcttgccacatttttggcccagttttacatggaaattgaaagtttcggagaagagttggtgaaagatccagtgagttcattgccctccttattagagagaattaatgacttgttcttcaaattagaggcgtctatcggccatctccatgcaatgcgcccgagtgattcttctgttgaaggaagctattcatttcccctagtatttgagaaattgcccgagataaatcaagacagatcccagtggacagactgtgaaattagggattcaatcaatttgatttctcaaaatttggagaaactggaatctcacttaacttttatagttgacaaacatcggaaaccaaggagggtaactcgatattggatcccctatacttgtggtgcggttggcctctcagtttgttctgtgtggctcataagacatagtcgtctgtcaggaagtcatgacatagataattgggttcgagaagctaaggattcaaccgtcagcttcttgcgtgatcatgttgagcaaccgctgctgtctattagagatgaactttttaagacattcaggcaaaggcacaaaggaatgatggagcttgaagaagtgcaattaacctccaattctctgcacagaatgttgttggctttcagtgagcagacaaaagggcaaaatttcccagagaatgcatctgatcaggaaatgcttgaaatagttatggctaggtatgaaaaggaacttgaacatcctattcataaccttgtaaatggcgagctggctcgtgccttgctgatccaggttcagaagctaaaactcgatactgaaaccgccatgcttgaattgaaccagattctgagggcaaatgagataaactttgcaatcctagctgctttaccagccttctttctctccctcattctgctaatgctagtgcgtgcatggttcaaacgggataaaagagcagaaggaaggggacgagttgctcggctccagaggaggttacttgttgtggaagttgagaagaggattatgcagtatcaaagttttatcgatcaagggatggagaaagaagcgctagacatgttcggattgttgttgtatagtctggatcgcctataccatgctgtcaaggggcatgcaaaagcaactggggaatggcagtggttgtgtcaggatatagttgacctggcaaagcccagccttcaaactgcatttaaactcagagtgacctcccggttggaacgggtttatgactgtttacttcctgcattgcagcgccagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NCA2

Protein Analysis

490

Amino Acids

56.54

Weight (kDa)

6.91

Isoelectric Point (pI)

38.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011465)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G12290 AT5G12290 AT5G12290 AT5G12290
fragaria_vesca FvH4_5g07960
malus_domestica MD03G1163400.v1.1
prunus_persica Prupe.4G269200_v2.0.a1
pyrus_communis pycom5153684g00200
rosa_chinensis RchiOBHm_Chr7g0190441
rosa_laevigata RLG00000004532
rosa_multiflora Rmu_sc0002614.1_g000003 Rmu_sc0029194.1_g000001
rosa_roxburghii Rroxscaffold_3G00264620
rosa_rugosa Rorug06G0504700
rosa_samantha Rh7AG110600 Rh7BG113200 Rh7CG115400 Rh7DG113700
rosa_wichuraiana Rw0G019860 Rw7G009600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 633
AccBSI CCGCTC 1 cut(s) 150
AciI CCGC 5 cut(s) 71, 148, 590, 722, 1017
AclWI GGATC 7 cut(s) 34, 266, 435, 565, 578, 976, 1305
AcoI YGGCCR 1 cut(s) 343
AcsI RAATTY 2 cut(s) 493, 862
AcuI CTGAAG 1 cut(s) 44
AcyI GRCGYC 1 cut(s) 335
AfaI GTAC 1 cut(s) 91
AfeI AGCGCT 1 cut(s) 1263
AflII CTTAAG 1 cut(s) 196
AflIII ACRYGT 2 cut(s) 165, 1269
AjnI CCWGG 2 cut(s) 984, 1374
AluBI AGCT 9 cut(s) 35, 195, 390, 677, 696, 787, 964, 997, 1076
AluI AGCT 9 cut(s) 35, 195, 390, 677, 696, 787, 964, 997, 1076
AlwI GGATC 7 cut(s) 34, 266, 435, 565, 578, 976, 1305
AlwNI CAGNNNCTG 1 cut(s) 1042
Ama87I CYCGRG 2 cut(s) 364, 422
Aor51HI AGCGCT 1 cut(s) 1263
AoxI GGCC 3 cut(s) 222, 343, 595
ApeKI GCWGC 3 cut(s) 724, 1076, 1462
ApoI RAATTY 2 cut(s) 493, 862
AseI ATTAAT 2 cut(s) 188, 309
Asp700I GAANNNNTTC 1 cut(s) 391
AspLEI GCGC 3 cut(s) 363, 1264, 1467
AspS9I GGNCC 2 cut(s) 68, 223
AsuC2I CCSGG 1 cut(s) 1423
AsuHPI GGTGA 2 cut(s) 131, 277
AvaI CYCGRG 2 cut(s) 364, 422
AvaII GGWCC 1 cut(s) 68
BamHI GGATCC 1 cut(s) 570
BauI CACGAG 1 cut(s) 969
BbvI GCAGC 2 cut(s) 711, 1063
BccI CCATC 5 cut(s) 80, 110, 354, 775, 1243
BciT130I CCWGG 2 cut(s) 986, 1376
BclI TGATCA 2 cut(s) 706, 883
BcnI CCSGG 1 cut(s) 1423
BfaI CTAG 5 cut(s) 404, 912, 1073, 1118, 1265
BfoI RGCGCY 2 cut(s) 1265, 1468
BfrI CTTAAG 1 cut(s) 196
BglII AGATCT 1 cut(s) 200
BisI GCNGC 4 cut(s) 148, 725, 1077, 1463
BlsI GCNGC 4 cut(s) 149, 726, 1078, 1464
Bme1390I CCNGG 3 cut(s) 986, 1376, 1423
Bme18I GGWCC 1 cut(s) 68
BmeT110I CYCGRG 2 cut(s) 364, 422
BmgT120I GGNCC 2 cut(s) 68, 223
BmiI GGNNCC 2 cut(s) 572, 1178
BmrFI CCNGG 3 cut(s) 986, 1376, 1423
BmrI ACTGGG 3 cut(s) 220, 439, 1347
BmsI GCATC 2 cut(s) 164, 887
BmuI ACTGGG 3 cut(s) 220, 439, 1347
BoxI GACNNNNGTC 1 cut(s) 12
BplI GAGNNNNNCTC 2 cut(s) 544, 576
BpmI CTGGAG 1 cut(s) 1163
Bpu10I CCTNAGC 1 cut(s) 678
BpuMI CCSGG 1 cut(s) 1423
Bsa29I ATCGAT 1 cut(s) 1239
BsaHI GRCGYC 1 cut(s) 335
BsaJI CCNNGG 1 cut(s) 548
Bse1I ACTGG 6 cut(s) 226, 275, 445, 510, 1342, 1468
Bse3DI GCAATG 3 cut(s) 284, 363, 1457
BseBI CCWGG 2 cut(s) 986, 1376
BseCI ATCGAT 1 cut(s) 1239
BseDI CCNNGG 1 cut(s) 548
BseGI GGATG 2 cut(s) 934, 1254
BseMI GCAATG 3 cut(s) 284, 363, 1457
BseMII CTCAG 4 cut(s) 162, 615, 1034, 1423
BseNI ACTGG 6 cut(s) 226, 275, 445, 510, 1342, 1468
BseRI GAGGAG 1 cut(s) 1198
BseXI GCAGC 2 cut(s) 711, 1063
BseYI CCCAGC 1 cut(s) 1385
BsgI GTGCAG 1 cut(s) 803
BshFI GGCC 3 cut(s) 224, 345, 597
BshVI ATCGAT 1 cut(s) 1239
BsiHKCI CYCGRG 2 cut(s) 364, 422
BsiSI CCGG 1 cut(s) 1423
BslFI GGGAC 1 cut(s) 1176
BsmFI GGGAC 1 cut(s) 1176
BsmI GAATGC 1 cut(s) 880
BsnI GGCC 3 cut(s) 224, 345, 597
BsoBI CYCGRG 2 cut(s) 364, 422
BspACI CCGC 5 cut(s) 71, 148, 590, 722, 1017
BspANI GGCC 3 cut(s) 224, 345, 597
BspCNI CTCAG 4 cut(s) 163, 614, 1035, 1422
BspDI ATCGAT 1 cut(s) 1239
BspHI TCATGA 1 cut(s) 649
BspLI GGNNCC 2 cut(s) 572, 1178
BspPI GGATC 7 cut(s) 34, 266, 435, 565, 578, 976, 1305
BspTI CTTAAG 1 cut(s) 196
BsrBI CCGCTC 1 cut(s) 150
BsrDI GCAATG 3 cut(s) 284, 363, 1457
BsrI ACTGG 6 cut(s) 226, 275, 445, 510, 1342, 1468
BssECI CCNNGG 1 cut(s) 548
BssNI GRCGYC 1 cut(s) 335
BssSI CACGAG 1 cut(s) 969
BssT1I CCWWGG 1 cut(s) 548
Bst2BI CACGAG 1 cut(s) 969
Bst2UI CCWGG 2 cut(s) 986, 1376
Bst4CI ACNGT 3 cut(s) 458, 691, 1445
Bst6I CTCTTC 2 cut(s) 252, 1205
BstACI GRCGYC 1 cut(s) 335
BstAFI CTTAAG 1 cut(s) 196
BstAPI GCANNNNNTGC 1 cut(s) 724
BstC8I GCNNGC 5 cut(s) 75, 962, 966, 1125, 1326
BstDEI CTNAG 5 cut(s) 171, 601, 678, 1043, 1409
BstF5I GGATG 2 cut(s) 934, 1254
BstH2I RGCGCY 2 cut(s) 1265, 1468
BstHHI GCGC 3 cut(s) 363, 1264, 1467
BstMWI GCNNNNNNNGC 3 cut(s) 724, 1073, 1085
BstNI CCWGG 2 cut(s) 986, 1376
BstNSI RCATGY 3 cut(s) 169, 1273, 1328
BstPAI GACNNNNGTC 1 cut(s) 12
BstSCI CCNGG 3 cut(s) 984, 1374, 1421
BstV1I GCAGC 2 cut(s) 711, 1063
BstX2I RGATCY 4 cut(s) 200, 271, 440, 570
BstXI CCANNNNNNTGG 1 cut(s) 220
BstYI RGATCY 4 cut(s) 200, 271, 440, 570
Bsu15I ATCGAT 1 cut(s) 1239
BsuRI GGCC 3 cut(s) 224, 345, 597
BsuTUI ATCGAT 1 cut(s) 1239
BtsCI GGATG 2 cut(s) 934, 1254
BtsI GCAGTG 1 cut(s) 1355
BtsIMutI CAGTG 4 cut(s) 282, 452, 847, 1355
Cac8I GCNNGC 5 cut(s) 75, 962, 966, 1125, 1326
CaiI CAGNNNCTG 1 cut(s) 1042
CciI TCATGA 1 cut(s) 649
CfoI GCGC 3 cut(s) 363, 1264, 1467
Cfr13I GGNCC 2 cut(s) 68, 223
ClaI ATCGAT 1 cut(s) 1239
CseI GACGC 1 cut(s) 324
Csp6I GTAC 1 cut(s) 90
CviQI GTAC 1 cut(s) 90
DdeI CTNAG 5 cut(s) 171, 601, 678, 1043, 1409
DraI TTTAAA 1 cut(s) 1405
DrdI GACNNNNNNGTC 1 cut(s) 633
DseDI GACNNNNNNGTC 1 cut(s) 633
EaeI YGGCCR 1 cut(s) 343
Eam1104I CTCTTC 2 cut(s) 252, 1205
EarI CTCTTC 2 cut(s) 252, 1205
Eco130I CCWWGG 1 cut(s) 548
Eco47I GGWCC 1 cut(s) 68
Eco47III AGCGCT 1 cut(s) 1263
Eco57I CTGAAG 1 cut(s) 44
Eco88I CYCGRG 2 cut(s) 364, 422
EcoRII CCWGG 2 cut(s) 984, 1374
EcoT14I CCWWGG 1 cut(s) 548
EcoT22I ATGCAT 1 cut(s) 880
ErhI CCWWGG 1 cut(s) 548
FaqI GGGAC 1 cut(s) 1176
FbaI TGATCA 2 cut(s) 706, 883
Fnu4HI GCNGC 4 cut(s) 148, 725, 1077, 1463
FokI GGATG 2 cut(s) 921, 1261
Fsp4HI GCNGC 4 cut(s) 148, 725, 1077, 1463
FspBI CTAG 5 cut(s) 404, 912, 1073, 1118, 1265
GlaI GCGC 3 cut(s) 362, 1263, 1466
GluI GCNGC 4 cut(s) 148, 725, 1077, 1463
GsaI CCCAGC 1 cut(s) 1389
GsuI CTGGAG 1 cut(s) 1163
HaeII RGCGCY 2 cut(s) 1265, 1468
HaeIII GGCC 3 cut(s) 224, 345, 597
HapII CCGG 1 cut(s) 1423
HgaI GACGC 1 cut(s) 324
HhaI GCGC 3 cut(s) 363, 1264, 1467
Hin1I GRCGYC 1 cut(s) 335
Hin6I GCGC 3 cut(s) 361, 1262, 1465
HinP1I GCGC 3 cut(s) 361, 1262, 1465
HincII GTYRAC 2 cut(s) 532, 1372
HindII GTYRAC 2 cut(s) 532, 1372
HinfI GANTC 5 cut(s) 371, 470, 509, 683, 1039
HpaII CCGG 1 cut(s) 1423
HphI GGTGA 2 cut(s) 131, 277
Hpy166II GTNNAC 4 cut(s) 450, 532, 1372, 1448
Hpy188I TCNGA 9 cut(s) 63, 172, 254, 543, 883, 993, 1044, 1277, 1412
Hpy188III TCNNGA 8 cut(s) 434, 642, 650, 671, 887, 1180, 1295, 1361
Hpy8I GTNNAC 4 cut(s) 450, 532, 1372, 1448
HpyAV CCTTC 5 cut(s) 377, 1099, 1148, 1152, 1400
HpyCH4III ACNGT 3 cut(s) 458, 691, 1445
HpyF10VI GCNNNNNNNGC 3 cut(s) 724, 1073, 1085
HpyF3I CTNAG 5 cut(s) 171, 601, 678, 1043, 1409
Hsp92I GRCGYC 1 cut(s) 335
HspAI GCGC 3 cut(s) 361, 1262, 1465
Ksp22I TGATCA 2 cut(s) 706, 883
LmnI GCTCC 2 cut(s) 784, 1182
Lsp1109I GCAGC 2 cut(s) 711, 1063
LweI GCATC 2 cut(s) 164, 887
MaeI CTAG 5 cut(s) 404, 912, 1073, 1118, 1265
MaeIII GTNAC 3 cut(s) 556, 1188, 1414
MbiI CCGCTC 1 cut(s) 150
MboII GAAGA 7 cut(s) 120, 195, 269, 313, 366, 803, 1222
MflI RGATCY 4 cut(s) 200, 271, 440, 570
MmeI TCCRAC 2 cut(s) 121, 1407
Mph1103I ATGCAT 1 cut(s) 880
MroXI GAANNNNTTC 1 cut(s) 391
MseI TTAA 8 cut(s) 45, 188, 197, 309, 518, 750, 803, 1404
MslI CAYNNNNRTG 1 cut(s) 351
MspA1I CMGCKG 1 cut(s) 724
MspCI CTTAAG 1 cut(s) 196
MspI CCGG 1 cut(s) 1423
MspR9I CCNGG 3 cut(s) 986, 1376, 1423
Mva1269I GAATGC 1 cut(s) 880
MvaI CCWGG 2 cut(s) 986, 1376
MwoI GCNNNNNNNGC 3 cut(s) 724, 1073, 1085
NciI CCSGG 1 cut(s) 1423
NlaIV GGNNCC 2 cut(s) 572, 1178
NmeAIII GCCGAG 1 cut(s) 1153
NmuCI GTSAC 1 cut(s) 1414
NsiI ATGCAT 1 cut(s) 880
NspI RCATGY 3 cut(s) 169, 1273, 1328
PaeI GCATGC 1 cut(s) 1328
PagI TCATGA 1 cut(s) 649
PciI ACATGT 2 cut(s) 165, 1269
PctI GAATGC 1 cut(s) 880
PdmI GAANNNNTTC 1 cut(s) 391
PfeI GAWTC 5 cut(s) 371, 470, 509, 683, 1039
PflFI GACNNNGTC 1 cut(s) 630
PkrI GCNGC 4 cut(s) 149, 726, 1078, 1464
PscI ACATGT 2 cut(s) 165, 1269
PshAI GACNNNNGTC 1 cut(s) 12
PshBI ATTAAT 2 cut(s) 188, 309
Psp6I CCWGG 2 cut(s) 984, 1374
PspFI CCCAGC 1 cut(s) 1385
PspGI CCWGG 2 cut(s) 984, 1374
PspN4I GGNNCC 2 cut(s) 572, 1178
PspPI GGNCC 2 cut(s) 68, 223
PstNI CAGNNNCTG 1 cut(s) 1042
PsuI RGATCY 4 cut(s) 200, 271, 440, 570
PsyI GACNNNGTC 1 cut(s) 630
RsaI GTAC 1 cut(s) 91
RsaNI GTAC 1 cut(s) 90
RseI CAYNNNNRTG 1 cut(s) 351
SaqAI TTAA 8 cut(s) 45, 188, 197, 309, 518, 750, 803, 1404
SatI GCNGC 4 cut(s) 148, 725, 1077, 1463
Sau96I GGNCC 2 cut(s) 68, 223
ScrFI CCNGG 3 cut(s) 986, 1376, 1423
SfaNI GCATC 2 cut(s) 164, 887
SinI GGWCC 1 cut(s) 68
SmiMI CAYNNNNRTG 1 cut(s) 351
SmlI CTYRAG 1 cut(s) 196
SmoI CTYRAG 1 cut(s) 196
SphI GCATGC 1 cut(s) 1328
SsiI CCGC 5 cut(s) 71, 148, 590, 722, 1017
SspMI CTAG 5 cut(s) 404, 912, 1073, 1118, 1265
StyD4I CCNGG 3 cut(s) 984, 1374, 1421
StyI CCWWGG 1 cut(s) 548
TaaI ACNGT 3 cut(s) 458, 691, 1445
TaqI TCGA 4 cut(s) 562, 670, 1005, 1239
TauI GCSGC 1 cut(s) 150
TfiI GAWTC 5 cut(s) 371, 470, 509, 683, 1039
Tru1I TTAA 8 cut(s) 45, 188, 197, 309, 518, 750, 803, 1404
Tru9I TTAA 8 cut(s) 45, 188, 197, 309, 518, 750, 803, 1404
TscAI CASTG 4 cut(s) 282, 452, 847, 1355
TseFI GTSAC 1 cut(s) 1414
TseI GCWGC 3 cut(s) 724, 1076, 1462
Tsp45I GTSAC 1 cut(s) 1414
TspDTI ATGAA 5 cut(s) 273, 384, 756, 932, 933
TspRI CASTG 4 cut(s) 282, 452, 847, 1355
Tth111I GACNNNGTC 1 cut(s) 630
Vha464I CTTAAG 1 cut(s) 196
VpaK11BI GGWCC 1 cut(s) 68
VspI ATTAAT 2 cut(s) 188, 309
XapI RAATTY 2 cut(s) 493, 862
XceI RCATGY 3 cut(s) 169, 1273, 1328
XcmI CCANNNNNNNNNTGG 1 cut(s) 104
XmnI GAANNNNTTC 1 cut(s) 391
XspI CTAG 5 cut(s) 404, 912, 1073, 1118, 1265
Zsp2I ATGCAT 1 cut(s) 880
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.