Rmu_sc0002963.1_g000004

disease resistance

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002963.1
OG0018654
Physical Location & Seq
Forward (+)
29043 .. 32132
3090 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002963.1_g000004.1.cds

Sequence Viewer

Length: 585 bp
atggctagaagtcttgcacaactcacacatcttgaggcatctgaatgtcaaaccatggaagaaatagtatcaagagaggaatttgatgaattgcatatgaatgacatgttctctaagctacaaaatctggagctaaaagatcttccaatcctcacaagattctgctcaagaagttatactggatttccatctttggagatttcgcaactaaagaactacaatgaaattgaagaaagggacttaagagaaaggatggccatcgatctttggtgggccgtcgtcttttgttcttcttctttcgggtggttttcgtacatacctagtcacagcggaggcaagaccattccgggtttggatttggatcggagggaccttgggcttttcggcaacggcggagttgaggtcggagaggagatcgaagcagaggagtggctgcgatggcttctgggcttgaaagggtcggagtgtgggagactgggagtgaaaggttcagagggttgttggtacgaaatgggtgtagaacgaggatggggccagagtcggagtcgctatggagaacgaggttgctgccttctggggcgttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

194

Amino Acids

22.19

Weight (kDa)

4.91

Isoelectric Point (pI)

61.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 330, 393
AclWI GGATC 1 cut(s) 369
AcoI YGGCCR 1 cut(s) 255
AcsI RAATTY 1 cut(s) 80
AfaI GTAC 2 cut(s) 314, 506
AflII CTTAAG 1 cut(s) 241
AflIII ACRYGT 1 cut(s) 105
AgsI TTSAA 2 cut(s) 230, 454
AluBI AGCT 2 cut(s) 118, 133
AluI AGCT 2 cut(s) 118, 133
Alw26I GTCTC 1 cut(s) 466
AlwI GGATC 1 cut(s) 369
AoxI GGCC 3 cut(s) 255, 273, 532
ApeKI GCWGC 2 cut(s) 433, 567
ApoI RAATTY 1 cut(s) 80
AspS9I GGNCC 3 cut(s) 273, 370, 532
AsuC2I CCSGG 1 cut(s) 348
AvaII GGWCC 1 cut(s) 370
BalI TGGCCA 1 cut(s) 257
BbvI GCAGC 2 cut(s) 420, 554
BccI CCATC 5 cut(s) 196, 247, 266, 432, 522
BceAI ACGGC 2 cut(s) 260, 406
BcgI CGANNNNNNTGC 2 cut(s) 549, 583
BcnI CCSGG 1 cut(s) 348
BcoDI GTCTC 1 cut(s) 466
BfaI CTAG 2 cut(s) 6, 321
BfrI CTTAAG 1 cut(s) 241
BglII AGATCT 1 cut(s) 139
BisI GCNGC 2 cut(s) 434, 568
BlsI GCNGC 2 cut(s) 435, 569
Bme1390I CCNGG 1 cut(s) 348
Bme18I GGWCC 1 cut(s) 370
BmgT120I GGNCC 3 cut(s) 273, 370, 532
BmiI GGNNCC 2 cut(s) 371, 533
BmrFI CCNGG 1 cut(s) 348
BmrI ACTGGG 1 cut(s) 485
BmsI GCATC 1 cut(s) 47
BmuI ACTGGG 1 cut(s) 485
BpmI CTGGAG 1 cut(s) 149
BpuEI CTTGAG 2 cut(s) 53, 151
BpuMI CCSGG 1 cut(s) 348
Bsa29I ATCGAT 1 cut(s) 261
BsaBI GATNNNNATC 3 cut(s) 187, 257, 360
BsaJI CCNNGG 2 cut(s) 54, 373
BsaXI ACNNNNNCTCC 2 cut(s) 387, 417
Bse1I ACTGG 2 cut(s) 184, 480
Bse8I GATNNNNATC 3 cut(s) 187, 257, 360
BseCI ATCGAT 1 cut(s) 261
BseDI CCNNGG 2 cut(s) 54, 373
BseGI GGATG 2 cut(s) 258, 533
BseJI GATNNNNATC 3 cut(s) 187, 257, 360
BseNI ACTGG 2 cut(s) 184, 480
BseRI GAGGAG 2 cut(s) 425, 440
BseXI GCAGC 2 cut(s) 420, 554
BshFI GGCC 3 cut(s) 257, 275, 534
BshVI ATCGAT 1 cut(s) 261
BsiSI CCGG 1 cut(s) 347
BslFI GGGAC 2 cut(s) 251, 383
BsmAI GTCTC 1 cut(s) 466
BsmFI GGGAC 2 cut(s) 251, 383
BsnI GGCC 3 cut(s) 257, 275, 534
Bsp143I GATC 4 cut(s) 139, 262, 361, 414
Bsp19I CCATGG 1 cut(s) 54
BspACI CCGC 2 cut(s) 330, 393
BspANI GGCC 3 cut(s) 257, 275, 534
BspDI ATCGAT 1 cut(s) 261
BspLI GGNNCC 2 cut(s) 371, 533
BspPI GGATC 1 cut(s) 369
BspTI CTTAAG 1 cut(s) 241
BsrI ACTGG 2 cut(s) 184, 480
BssECI CCNNGG 2 cut(s) 54, 373
BssMI GATC 4 cut(s) 139, 262, 361, 414
BssT1I CCWWGG 2 cut(s) 54, 373
BstAFI CTTAAG 1 cut(s) 241
BstDEI CTNAG 1 cut(s) 114
BstDSI CCRYGG 1 cut(s) 54
BstF5I GGATG 2 cut(s) 258, 533
BstKTI GATC 4 cut(s) 142, 265, 364, 417
BstMAI GTCTC 1 cut(s) 466
BstMBI GATC 4 cut(s) 139, 262, 361, 414
BstMWI GCNNNNNNNGC 1 cut(s) 439
BstNSI RCATGY 1 cut(s) 109
BstSCI CCNGG 1 cut(s) 346
BstV1I GCAGC 2 cut(s) 420, 554
BstX2I RGATCY 1 cut(s) 139
BstYI RGATCY 1 cut(s) 139
Bsu15I ATCGAT 1 cut(s) 261
BsuRI GGCC 3 cut(s) 257, 275, 534
BsuTUI ATCGAT 1 cut(s) 261
BtgI CCRYGG 1 cut(s) 54
BtgZI GCGATG 1 cut(s) 451
BtsCI GGATG 2 cut(s) 258, 533
Cfr13I GGNCC 3 cut(s) 273, 370, 532
ClaI ATCGAT 1 cut(s) 261
Csp6I GTAC 2 cut(s) 313, 505
CviAII CATG 2 cut(s) 55, 106
CviQI GTAC 2 cut(s) 313, 505
DdeI CTNAG 1 cut(s) 114
DpnI GATC 4 cut(s) 141, 264, 363, 416
DpnII GATC 4 cut(s) 139, 262, 361, 414
EaeI YGGCCR 1 cut(s) 255
EciI GGCGGA 1 cut(s) 408
Eco130I CCWWGG 2 cut(s) 54, 373
Eco47I GGWCC 1 cut(s) 370
EcoO109I RGGNCCY 1 cut(s) 370
EcoT14I CCWWGG 2 cut(s) 54, 373
ErhI CCWWGG 2 cut(s) 54, 373
FaeI CATG 2 cut(s) 58, 109
FaiI YATR 7 cut(s) 56, 96, 98, 107, 177, 317, 552
FaqI GGGAC 2 cut(s) 251, 383
FatI CATG 2 cut(s) 54, 105
FauNDI CATATG 1 cut(s) 96
Fnu4HI GCNGC 2 cut(s) 434, 568
FokI GGATG 2 cut(s) 265, 540
Fsp4HI GCNGC 2 cut(s) 434, 568
FspBI CTAG 2 cut(s) 6, 321
GluI GCNGC 2 cut(s) 434, 568
GsuI CTGGAG 1 cut(s) 149
HaeIII GGCC 3 cut(s) 257, 275, 534
HapII CCGG 1 cut(s) 347
Hin1II CATG 2 cut(s) 58, 109
HinfI GANTC 3 cut(s) 159, 538, 544
HpaII CCGG 1 cut(s) 347
Hpy188I TCNGA 6 cut(s) 43, 366, 407, 463, 493, 543
Hpy188III TCNNGA 4 cut(s) 32, 72, 128, 168
Hpy99I CGWCG 1 cut(s) 281
HpyAV CCTTC 1 cut(s) 581
HpyCH4V TGCA 2 cut(s) 17, 94
HpyF10VI GCNNNNNNNGC 1 cut(s) 439
HpyF3I CTNAG 1 cut(s) 114
Hsp92II CATG 2 cut(s) 58, 109
Kzo9I GATC 4 cut(s) 139, 262, 361, 414
LmnI GCTCC 1 cut(s) 130
LpnPI CCDG 7 cut(s) 113, 165, 360, 431, 461, 548, 560
Lsp1109I GCAGC 2 cut(s) 420, 554
LweI GCATC 1 cut(s) 47
MaeI CTAG 2 cut(s) 6, 321
MaeIII GTNAC 1 cut(s) 323
MalI GATC 4 cut(s) 141, 264, 363, 416
MboI GATC 4 cut(s) 139, 262, 361, 414
MboII GAAGA 5 cut(s) 71, 134, 242, 282, 285
MflI RGATCY 1 cut(s) 139
MlsI TGGCCA 1 cut(s) 257
MluCI AATT 3 cut(s) 80, 89, 225
MluNI TGGCCA 1 cut(s) 257
MlyI GAGTC 2 cut(s) 547, 553
MmeI TCCRAC 3 cut(s) 385, 441, 521
Mox20I TGGCCA 1 cut(s) 257
MscI TGGCCA 1 cut(s) 257
MseI TTAA 1 cut(s) 242
MslI CAYNNNNRTG 2 cut(s) 43, 99
Msp20I TGGCCA 1 cut(s) 257
MspA1I CMGCKG 1 cut(s) 330
MspCI CTTAAG 1 cut(s) 241
MspI CCGG 1 cut(s) 347
MspR9I CCNGG 1 cut(s) 348
MwoI GCNNNNNNNGC 1 cut(s) 439
NciI CCSGG 1 cut(s) 348
NcoI CCATGG 1 cut(s) 54
NdeI CATATG 1 cut(s) 96
NdeII GATC 4 cut(s) 139, 262, 361, 414
NlaIII CATG 2 cut(s) 58, 109
NlaIV GGNNCC 2 cut(s) 371, 533
NmuCI GTSAC 1 cut(s) 323
NspI RCATGY 1 cut(s) 109
PciI ACATGT 1 cut(s) 105
PfeI GAWTC 1 cut(s) 159
PkrI GCNGC 2 cut(s) 435, 569
PleI GAGTC 2 cut(s) 546, 552
PpsI GAGTC 2 cut(s) 546, 552
PpuMI RGGWCCY 1 cut(s) 370
PscI ACATGT 1 cut(s) 105
Psp5II RGGWCCY 1 cut(s) 370
PspN4I GGNNCC 2 cut(s) 371, 533
PspPI GGNCC 3 cut(s) 273, 370, 532
PspPPI RGGWCCY 1 cut(s) 370
PsuI RGATCY 1 cut(s) 139
RsaI GTAC 2 cut(s) 314, 506
RsaNI GTAC 2 cut(s) 313, 505
RseI CAYNNNNRTG 2 cut(s) 43, 99
SaqAI TTAA 1 cut(s) 242
SatI GCNGC 2 cut(s) 434, 568
Sau3AI GATC 4 cut(s) 139, 262, 361, 414
Sau96I GGNCC 3 cut(s) 273, 370, 532
SchI GAGTC 2 cut(s) 547, 553
ScrFI CCNGG 1 cut(s) 348
SetI ASST 7 cut(s) 120, 135, 322, 375, 405, 490, 565
SfaNI GCATC 1 cut(s) 47
SinI GGWCC 1 cut(s) 370
SmiMI CAYNNNNRTG 2 cut(s) 43, 99
SmlI CTYRAG 3 cut(s) 32, 166, 241
SmoI CTYRAG 3 cut(s) 32, 166, 241
Sse9I AATT 3 cut(s) 80, 89, 225
SsiI CCGC 2 cut(s) 330, 393
SspMI CTAG 2 cut(s) 6, 321
StyD4I CCNGG 1 cut(s) 346
StyI CCWWGG 2 cut(s) 54, 373
TaqI TCGA 2 cut(s) 261, 417
TasI AATT 3 cut(s) 80, 89, 225
TfiI GAWTC 1 cut(s) 159
Tru1I TTAA 1 cut(s) 242
Tru9I TTAA 1 cut(s) 242
TseFI GTSAC 1 cut(s) 323
TseI GCWGC 2 cut(s) 433, 567
Tsp45I GTSAC 1 cut(s) 323
TspDTI ATGAA 3 cut(s) 102, 113, 237
Vha464I CTTAAG 1 cut(s) 241
VpaK11BI GGWCC 1 cut(s) 370
XapI RAATTY 1 cut(s) 80
XceI RCATGY 1 cut(s) 109
XcmI CCANNNNNNNNNTGG 1 cut(s) 349
XspI CTAG 2 cut(s) 6, 321
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.