Rmu_sc0003043.1_g000002

Pleckstrin homology domain.

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003043.1
Physical Location & Seq
Reverse (-)
5954 .. 7514
1561 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003043.1_g000002.1.cds

Sequence Viewer

Length: 693 bp
atggcctccaatggcgctgctccgagagttgcagacccagagaatagcttggagaagatcaagcgccagctcgcttccggttcgggtcggaacttgctccagggcccacttctcaagcgatccgagactctgcgaaagtggaacgagcggtggatgatcttagacccgacgacagggagaatggaatacaagattaggagaaatgagccgagtgtgaagggaaccattctatttgatgcgaatagcacaatcgccctatctccagttaactttcatgggttggcaaagtatgatggctgctgtttctatattgggaccccgcagaaaaaagactatttcctttgtgcagaaactcctggtgcggccagagcttgggtatcaacgttacaagcaacacagttggtcctaaaggcccataaagaagctgtgaattccttgagcggcaatggttcagcaaaattaggaactgttgctgcagtagttgctgctgcaaattcaactgctgcagagagttctaaggaaattgaagcagcaatgcatatttctttgagaaatgctttgggaatgataacccagaagccaactgatggtcccatggatgattttgcagtaatgaaggtactctgccctaaattcaaatttgaaataacgtatcttttcttaatgattagctctcgttgcacttctacttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

230

Amino Acids

25.03

Weight (kDa)

9.4

Isoelectric Point (pI)

43.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 372, 587
AccBSI CCGCTC 2 cut(s) 148, 441
AciI CCGC 4 cut(s) 148, 320, 362, 441
AclI AACGTT 1 cut(s) 383
AclWI GGATC 1 cut(s) 114
AcoI YGGCCR 1 cut(s) 363
AcsI RAATTY 4 cut(s) 430, 493, 632, 638
AfaI GTAC 1 cut(s) 621
AfiI CCNNNNNNNGG 3 cut(s) 173, 372, 587
AgsI TTSAA 4 cut(s) 498, 527, 637, 644
AjnI CCWGG 2 cut(s) 99, 355
AluBI AGCT 5 cut(s) 48, 70, 371, 425, 672
AluI AGCT 5 cut(s) 48, 70, 371, 425, 672
Alw26I GTCTC 1 cut(s) 119
AlwI GGATC 1 cut(s) 114
AoxI GGCC 4 cut(s) 3, 103, 363, 411
ApaI GGGCCC 1 cut(s) 107
ApeKI GCWGC 7 cut(s) 17, 297, 473, 485, 488, 503, 530
ApoI RAATTY 4 cut(s) 430, 493, 632, 638
AspLEI GCGC 2 cut(s) 17, 66
AspS9I GGNCC 6 cut(s) 103, 104, 315, 403, 412, 590
AvaII GGWCC 3 cut(s) 315, 403, 590
BaeGI GKGCMC 1 cut(s) 107
BanII GRGCYC 1 cut(s) 107
BbvI GCAGC 7 cut(s) 4, 284, 460, 472, 475, 490, 542
BccI CCATC 2 cut(s) 287, 581
BciT130I CCWGG 2 cut(s) 101, 357
BcoDI GTCTC 1 cut(s) 119
BfmI CTRYAG 2 cut(s) 474, 504
BfoI RGCGCY 2 cut(s) 18, 67
BisI GCNGC 9 cut(s) 18, 298, 363, 442, 474, 486, 489, 504, 531
BlsI GCNGC 9 cut(s) 19, 299, 364, 443, 475, 487, 490, 505, 532
Bme1390I CCNGG 2 cut(s) 101, 357
Bme18I GGWCC 3 cut(s) 315, 403, 590
BmgT120I GGNCC 6 cut(s) 103, 104, 315, 403, 412, 590
BmiI GGNNCC 5 cut(s) 105, 223, 316, 317, 592
BmrFI CCNGG 2 cut(s) 101, 357
BmsI GCATC 1 cut(s) 226
BpmI CTGGAG 2 cut(s) 83, 246
BpuEI CTTGAG 2 cut(s) 98, 457
BsaJI CCNNGG 2 cut(s) 100, 594
BsaWI WCCGGW 1 cut(s) 77
Bsc4I CCNNNNNNNGG 3 cut(s) 173, 372, 587
Bse1I ACTGG 1 cut(s) 263
Bse3DI GCAATG 2 cut(s) 451, 540
BseBI CCWGG 2 cut(s) 101, 357
BseDI CCNNGG 2 cut(s) 100, 594
BseGI GGATG 2 cut(s) 159, 604
BseLI CCNNNNNNNGG 3 cut(s) 173, 372, 587
BseMI GCAATG 2 cut(s) 451, 540
BseNI ACTGG 1 cut(s) 263
BseSI GKGCMC 1 cut(s) 107
BseXI GCAGC 7 cut(s) 4, 284, 460, 472, 475, 490, 542
BsgI GTGCAG 1 cut(s) 366
BshFI GGCC 4 cut(s) 5, 105, 365, 413
BsiSI CCGG 1 cut(s) 78
BslFI GGGAC 2 cut(s) 328, 576
BslI CCNNNNNNNGG 3 cut(s) 173, 372, 587
BsmAI GTCTC 1 cut(s) 119
BsmFI GGGAC 2 cut(s) 328, 576
BsnI GGCC 4 cut(s) 5, 105, 365, 413
Bsp120I GGGCCC 1 cut(s) 103
Bsp1286I GDGCHC 1 cut(s) 107
Bsp143I GATC 3 cut(s) 57, 119, 156
Bsp19I CCATGG 1 cut(s) 594
BspACI CCGC 4 cut(s) 148, 320, 362, 441
BspANI GGCC 4 cut(s) 5, 105, 365, 413
BspLI GGNNCC 5 cut(s) 105, 223, 316, 317, 592
BspMAI CTGCAG 2 cut(s) 478, 508
BspPI GGATC 1 cut(s) 114
BsrBI CCGCTC 2 cut(s) 148, 441
BsrDI GCAATG 2 cut(s) 451, 540
BsrI ACTGG 1 cut(s) 263
BssECI CCNNGG 2 cut(s) 100, 594
BssMI GATC 3 cut(s) 57, 119, 156
BssT1I CCWWGG 1 cut(s) 594
Bst2UI CCWGG 2 cut(s) 101, 357
Bst4CI ACNGT 2 cut(s) 399, 469
BstAPI GCANNNNNTGC 1 cut(s) 482
BstC8I GCNNGC 2 cut(s) 68, 72
BstDEI CTNAG 2 cut(s) 160, 516
BstDSI CCRYGG 1 cut(s) 594
BstF5I GGATG 2 cut(s) 159, 604
BstH2I RGCGCY 2 cut(s) 18, 67
BstHHI GCGC 2 cut(s) 17, 66
BstKTI GATC 3 cut(s) 60, 122, 159
BstMAI GTCTC 1 cut(s) 119
BstMBI GATC 3 cut(s) 57, 119, 156
BstMWI GCNNNNNNNGC 3 cut(s) 368, 482, 678
BstNI CCWGG 2 cut(s) 101, 357
BstSCI CCNGG 2 cut(s) 99, 355
BstSFI CTRYAG 2 cut(s) 474, 504
BstSLI GKGCMC 1 cut(s) 107
BstV1I GCAGC 7 cut(s) 4, 284, 460, 472, 475, 490, 542
BsuRI GGCC 4 cut(s) 5, 105, 365, 413
BtgI CCRYGG 1 cut(s) 594
BtsCI GGATG 2 cut(s) 159, 604
Cac8I GCNNGC 2 cut(s) 68, 72
CfoI GCGC 2 cut(s) 17, 66
Cfr13I GGNCC 6 cut(s) 103, 104, 315, 403, 412, 590
Csp6I GTAC 1 cut(s) 620
CviAII CATG 2 cut(s) 275, 595
CviQI GTAC 1 cut(s) 620
DdeI CTNAG 2 cut(s) 160, 516
DpnI GATC 3 cut(s) 59, 121, 158
DpnII GATC 3 cut(s) 57, 119, 156
EaeI YGGCCR 1 cut(s) 363
Eco130I CCWWGG 1 cut(s) 594
Eco24I GRGCYC 1 cut(s) 107
Eco47I GGWCC 3 cut(s) 315, 403, 590
EcoO109I RGGNCCY 2 cut(s) 103, 315
EcoRI GAATTC 1 cut(s) 430
EcoRII CCWGG 2 cut(s) 99, 355
EcoT14I CCWWGG 1 cut(s) 594
EcoT22I ATGCAT 1 cut(s) 540
EcoT38I GRGCYC 1 cut(s) 107
ErhI CCWWGG 1 cut(s) 594
FaeI CATG 2 cut(s) 278, 598
FaiI YATR 6 cut(s) 276, 291, 309, 417, 540, 596
FaqI GGGAC 2 cut(s) 328, 576
FatI CATG 2 cut(s) 274, 594
FauI CCCGC 1 cut(s) 327
Fnu4HI GCNGC 9 cut(s) 18, 298, 363, 442, 474, 486, 489, 504, 531
FokI GGATG 2 cut(s) 166, 611
FriOI GRGCYC 1 cut(s) 107
Fsp4HI GCNGC 9 cut(s) 18, 298, 363, 442, 474, 486, 489, 504, 531
GlaI GCGC 2 cut(s) 16, 65
GluI GCNGC 9 cut(s) 18, 298, 363, 442, 474, 486, 489, 504, 531
GsuI CTGGAG 2 cut(s) 83, 246
HaeII RGCGCY 2 cut(s) 18, 67
HaeIII GGCC 4 cut(s) 5, 105, 365, 413
HapII CCGG 1 cut(s) 78
HhaI GCGC 2 cut(s) 17, 66
Hin1II CATG 2 cut(s) 278, 598
Hin6I GCGC 2 cut(s) 15, 64
HinP1I GCGC 2 cut(s) 15, 64
HincII GTYRAC 1 cut(s) 268
HindII GTYRAC 1 cut(s) 268
HinfI GANTC 1 cut(s) 127
HpaI GTTAAC 1 cut(s) 268
HpaII CCGG 1 cut(s) 78
Hpy166II GTNNAC 1 cut(s) 268
Hpy188I TCNGA 3 cut(s) 24, 90, 124
Hpy8I GTNNAC 1 cut(s) 268
Hpy99I CGWCG 1 cut(s) 172
HpyAV CCTTC 2 cut(s) 211, 610
HpyCH4III ACNGT 2 cut(s) 399, 469
HpyCH4IV ACGT 2 cut(s) 383, 650
HpyCH4V TGCA 8 cut(s) 32, 347, 476, 491, 506, 538, 608, 681
HpyF10VI GCNNNNNNNGC 3 cut(s) 368, 482, 678
HpyF3I CTNAG 2 cut(s) 160, 516
HpySE526I ACGT 2 cut(s) 383, 650
Hsp92II CATG 2 cut(s) 278, 598
HspAI GCGC 2 cut(s) 15, 64
KflI GGGWCCC 1 cut(s) 315
KspAI GTTAAC 1 cut(s) 268
Kzo9I GATC 3 cut(s) 57, 119, 156
LmnI GCTCC 2 cut(s) 25, 102
Lsp1109I GCAGC 7 cut(s) 4, 284, 460, 472, 475, 490, 542
LweI GCATC 1 cut(s) 226
MaeII ACGT 2 cut(s) 383, 650
MaeIII GTNAC 1 cut(s) 384
MalI GATC 3 cut(s) 59, 121, 158
MbiI CCGCTC 2 cut(s) 148, 441
MboI GATC 3 cut(s) 57, 119, 156
MboII GAAGA 1 cut(s) 67
MhlI GDGCHC 1 cut(s) 107
MluCI AATT 6 cut(s) 430, 458, 493, 522, 632, 638
MlyI GAGTC 1 cut(s) 121
MmeI TCCRAC 1 cut(s) 68
MnlI CCTC 1 cut(s) 16
Mph1103I ATGCAT 1 cut(s) 540
MseI TTAA 3 cut(s) 267, 662, 691
MspI CCGG 1 cut(s) 78
MspR9I CCNGG 2 cut(s) 101, 357
MvaI CCWGG 2 cut(s) 101, 357
MwoI GCNNNNNNNGC 3 cut(s) 368, 482, 678
NcoI CCATGG 1 cut(s) 594
NdeII GATC 3 cut(s) 57, 119, 156
NlaIII CATG 2 cut(s) 278, 598
NlaIV GGNNCC 5 cut(s) 105, 223, 316, 317, 592
NmeAIII GCCGAG 1 cut(s) 234
NsiI ATGCAT 1 cut(s) 540
PflMI CCANNNNNTGG 2 cut(s) 372, 587
PkrI GCNGC 9 cut(s) 19, 299, 364, 443, 475, 487, 490, 505, 532
PleI GAGTC 1 cut(s) 121
PpsI GAGTC 1 cut(s) 121
PpuMI RGGWCCY 1 cut(s) 315
Psp1406I AACGTT 1 cut(s) 383
Psp5II RGGWCCY 1 cut(s) 315
Psp6I CCWGG 2 cut(s) 99, 355
PspGI CCWGG 2 cut(s) 99, 355
PspN4I GGNNCC 5 cut(s) 105, 223, 316, 317, 592
PspOMI GGGCCC 1 cut(s) 103
PspPI GGNCC 6 cut(s) 103, 104, 315, 403, 412, 590
PspPPI RGGWCCY 1 cut(s) 315
PstI CTGCAG 2 cut(s) 478, 508
RsaI GTAC 1 cut(s) 621
RsaNI GTAC 1 cut(s) 620
SaqAI TTAA 3 cut(s) 267, 662, 691
SatI GCNGC 9 cut(s) 18, 298, 363, 442, 474, 486, 489, 504, 531
Sau3AI GATC 3 cut(s) 57, 119, 156
Sau96I GGNCC 6 cut(s) 103, 104, 315, 403, 412, 590
SchI GAGTC 1 cut(s) 121
ScrFI CCNGG 2 cut(s) 101, 357
SduI GDGCHC 1 cut(s) 107
SetI ASST 8 cut(s) 50, 72, 373, 386, 427, 621, 653, 674
SfaNI GCATC 1 cut(s) 226
SfcI CTRYAG 2 cut(s) 474, 504
SinI GGWCC 3 cut(s) 315, 403, 590
SmlI CTYRAG 2 cut(s) 113, 436
SmoI CTYRAG 2 cut(s) 113, 436
Sse9I AATT 6 cut(s) 430, 458, 493, 522, 632, 638
SsiI CCGC 4 cut(s) 148, 320, 362, 441
StyD4I CCNGG 2 cut(s) 99, 355
StyI CCWWGG 1 cut(s) 594
TaaI ACNGT 2 cut(s) 399, 469
TaiI ACGT 2 cut(s) 386, 653
TasI AATT 6 cut(s) 430, 458, 493, 522, 632, 638
TauI GCSGC 2 cut(s) 365, 444
Tru1I TTAA 3 cut(s) 267, 662, 691
Tru9I TTAA 3 cut(s) 267, 662, 691
TseI GCWGC 7 cut(s) 17, 297, 473, 485, 488, 503, 530
TspDTI ATGAA 2 cut(s) 263, 629
Van91I CCANNNNNTGG 2 cut(s) 372, 587
VpaK11BI GGWCC 3 cut(s) 315, 403, 590
XapI RAATTY 4 cut(s) 430, 493, 632, 638
Zsp2I ATGCAT 1 cut(s) 540
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.