Rmu_sc0003334.1_g000002

Protein kinase C conserved region 2 (CalB)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003334.1
Physical Location & Seq
Reverse (-)
4575 .. 8659
4085 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003334.1_g000002.1.cds

Sequence Viewer

Length: 3939 bp
atgtcgatcctaaacccattccaacttctagaactgaacgtgatctcagcgcaagaccttgccccggtatcacgttccatgcggacgtacgccattgcatgggtgcacccggatcgcaagctgtcgacccgggtggacacgcacggccacaacaaccctacgtggaacgacaagttcgtgttccgggtggacgaggatttcttgcatgaggacacctccgccgtgatgatcgagatctacgccctccactggttcaaagacgtccacgtcggcaccatccgtgtcctcgtcggcaatctcatccccactccggtgaagccccaccaccaccatcctcagctgggcatgcgcttcgtggcgctccaggtacggcggccctccggccggccacaggggatattgaacatcggtgtggcgctgcttcacagctccatgcgcagcatgcctttgtattctcagctcagcgcatccgccgtgggatataaacagttaatgggggaggacgacccgccgcggagtcaaacccaccggagtcagtcaacgttttcaaaagcggagctgagacgcagcaagagtgactgcagctccatgttggcgtcggagatccggaccaaggaatttacgaaaaaggacaaaaagagcagagggagctcggtggtcagcgggtccgacgtcagcagccaaaagaataagaagggccgatccaaggccagctcgttaatcaacggctcagaaatcatcaggggaaggggtagaaaagggaaagccagctccgtggtcagctcgtcagaattaagccggaccaagggcaaaaacggaaaaccaagttccatactcagcgtctccgacgttggtggggccaaggacaaaaagggaaaaccaagttccatactcagcgtctccgacgttggtggggccaaggacaaaaagggaaaaccaagttccatactcagcgtctccgacgttggtggggccaaggacaaaaagggaaaaccaagttccatactcagcgtctccgacgttggtggggccaaggacaaaaagggaaaaccaagttccatactcagcgtctccgacgttggtggggccaaggacaaaaagggaaaaccaagttccatactcagcgtctccgacgttggtggggccaaggacaaaaagggaaaaccaagttccatactcagcgtctccgacgttggtggggccaaggacaaaaagggaaaaccaagttccatactcagcgtctccgacgttggtggggccaaggacaaaaacggaaaaccaagttccatactcagcgtctccgacgttggtggggccaaggacaaaaagggaaaaccaagttccatactcagcgtctccgaaatcagcatcagcgacccgtcaaagagaggcggtagggatccgaaaccgacgagcggatccgaaccggacgacccggtgagaaagcccaagcacaacgggaactacagagccgcggtcgtacacgacatcctggccgcgtcgccgttatcgaagccgtcgccgaagtacgtggtggagagttacggaaatacccctgggcggaggtcctcggttccggggaagtcgccgttcaagatggggacgtacgaccagtacgtgacgccgcggaagtcgaatctgatggtgccgccgtacctgacggagtcggagctggggccgtcgccgtcggaggtggcggcggcgatcgcgaaggagaggatggaccaggacaacgagagctcggtggtggtgggggcctggaacgaggacgagagcgtggaggggctacagtcgaagctggagcggtggcggacggagctgccgccggtgtacgatcgcggcgattattcgagctttccgagcagcagcgaagggcaccacacgcggcggcacaccgacggaggcggcggcccggggctgttctcgtgcttcagtaacatctgcggcgtggagtgctccatcgtgtgcggcggcggcgacgccggtaaggatcggaagaaggcggggggcagcaagagtagcggtccggtcgggcggagcccatcagcggagaatctgagctatgatttcttgcatgaggacacctccgccgtgatgatcgagatctacgccctccactggttcaaagacgtccacgtcggcaccatccgtgtcctcgtcggcaatctcatccccactccggtgaagccccaccaccaccatcctcagctgggcatgcgcttcgtggctctccaggtccggcggccctccggccggccacaggggatattgaacatcggtgtggcgctgcttcacagctccatgcgcagcatgcctttgtattctcagctcagcgcatccgccgtgggatataaacagttaatgggggaggacgacccgccgcggagtcaaacccaccggagtcagtcaacgttttcaaaagcggagctgagacgcagcaagagtgactgcagctccatgttggcgtcggagatccggaccaaggaatttacgaaaaaggacaaaaagagcagagggagctcggtggtcagcgggtccgacgtcagcagccaaaagaataagaagggccgatccaaggccagctcgttaatcaacggctcagaaatcatcaggggaaggggtagaaaagggaaagccagctccgtggtcagctcgtcagaattaagccggaccaagggcaaaaacggaaaaccaagttccatactcagcgtctccgacgttggtggggccaaggacaaaaagggaaaaccaagttccatactcagcgtctccgacgttggtggggccaaggacaaaaagggaaaaccaagttccatactcagcgtctccgacgttggtggggccaaggacaaaaagggaaaaccaagttccatactcagcgtctccgacgttggtggggccaaggacaaaaagggaaaaccaagttccatactcagcgtctccgacgttggtggggccaaggacaaaaagggaaaaccaagttccatactcagcgtctccgacgttggtggggccaaggacaaaaagggaaaaccaagttccatactcagcgtctccgacgttggtggggccaaggacaaaaagggaaaaccaagttccatactcagcgtctccgacgttggtggggccaaggacaaaaagggaaaaccaagttccatactcagcgtctccgacgttggtggggccaaggacaaaaagggaaaaccaagttccatactcagcgtctccgaaatcagcatcagcgacccgtcaaagagaggcggtagggatccgaaaccgacgagcggatccgaaccggacgacccggtgagaaagcccaagcacaacgggaactacagagccgcggtcgtacacgacatcctggccgcgtcgccgttatcgaagccgtcgccgaagtacgtggtggagagttacggaaatacccctgggcggaggtcctcggttccggggaagtcgccgttcaagatggggacgtacgaccagtacgtgacgccgcggaagtcgaatctgatggtgccgccgtacctgacggagtcggagctggggccgtcgccgtcggaggtggcggcggcgatcgcgaaggagaggatggaccaggacaacgagagctcggtggtggtgggggcctggaacgaggacgagagcgtggaggggctacagtcgaagctggagcggtggcggacggagctgccgccggtgtacgatcgcggcgattattcgagctttccgagcagcagcgaagggcaccacacgcggcggcacaccgacggaggcggcggcccggggctgttctcgtgcttcagtaacatctgcggcgtggagtgctccatcgtgtgcggcggcggcgacgccggtaaggatcggaagaaggcggggggcagcaagagtagcggtccggtcgggcggagcccatcagcggagaatctgagctatgtttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

1312

Amino Acids

138.53

Weight (kDa)

9.81

Isoelectric Point (pI)

50.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013477)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 266, 2135
AatII GACGTC 4 cut(s) 264, 675, 2133, 2544
Acc16I TGCGCA 2 cut(s) 437, 2306
AccB1I GGYRCC 6 cut(s) 272, 1645, 1875, 2141, 3514, 3744
AccB7I CCANNNNNTGG 1 cut(s) 99
AccBSI CCGCTC 4 cut(s) 1416, 1804, 3285, 3673
AccI GTMKAC 1 cut(s) 125
AccIII TCCGGA 2 cut(s) 606, 2475
AclI AACGTT 2 cut(s) 542, 2411
AcoI YGGCCR 7 cut(s) 145, 382, 386, 1494, 2251, 2255, 3363
AcsI RAATTY 2 cut(s) 617, 2486
AcuI CTGAAG 2 cut(s) 1915, 3784
AgsI TTSAA 8 cut(s) 256, 403, 549, 1594, 2125, 2272, 2418, 3463
AjiI CACGTC 2 cut(s) 268, 2137
AleI CACNNNNGTG 2 cut(s) 311, 2180
Alw21I GWGCWC 7 cut(s) 108, 653, 1742, 1958, 2522, 3611, 3827
Alw44I GTGCAC 1 cut(s) 104
Ama87I CYCGRG 3 cut(s) 129, 1912, 3781
Aor13HI TCCGGA 2 cut(s) 606, 2475
ApaLI GTGCAC 1 cut(s) 104
ApoI RAATTY 2 cut(s) 617, 2486
AsiSI GCGATCGC 2 cut(s) 1707, 3576
AsuHPI GGTGA 4 cut(s) 325, 1450, 2194, 3319
AvaI CYCGRG 3 cut(s) 129, 1912, 3781
BaeGI GKGCMC 3 cut(s) 108, 1878, 3747
BamHI GGATCC 4 cut(s) 1399, 1418, 3268, 3287
BanI GGYRCC 6 cut(s) 272, 1645, 1875, 2141, 3514, 3744
BanII GRGCYC 6 cut(s) 653, 1742, 2042, 2522, 3611, 3911
BauI CACGAG 2 cut(s) 1924, 3793
Bbv12I GWGCWC 7 cut(s) 108, 653, 1742, 1958, 2522, 3611, 3827
BbvCI CCTCAGC 2 cut(s) 336, 2205
BcgI CGANNNNNNTGC 6 cut(s) 95, 129, 334, 368, 2203, 2237
BfaI CTAG 1 cut(s) 29
BfmI CTRYAG 6 cut(s) 580, 1465, 1787, 2449, 3334, 3656
BfoI RGCGCY 3 cut(s) 362, 419, 2288
BglII AGATCT 2 cut(s) 234, 2103
BlpI GCTNAGC 2 cut(s) 461, 2330
BmeT110I CYCGRG 3 cut(s) 129, 1912, 3781
BmgBI CACGTC 2 cut(s) 268, 2137
BmsI GCATC 4 cut(s) 476, 1377, 2345, 3246
BplI GAGNNNNNCTC 4 cut(s) 200, 232, 2069, 2101
BpmI CTGGAG 4 cut(s) 347, 1820, 2216, 3689
Bpu10I CCTNAGC 2 cut(s) 336, 2205
Bpu1102I GCTNAGC 2 cut(s) 461, 2330
BsaAI YACGTR 5 cut(s) 162, 1531, 1618, 3400, 3487
BsaBI GATNNNNATC 2 cut(s) 233, 2102
BsaXI ACNNNNNCTCC 4 cut(s) 569, 599, 2438, 2468
Bse118I RCCGGY 6 cut(s) 384, 1825, 1982, 2253, 3694, 3851
Bse1I ACTGG 4 cut(s) 254, 1612, 2123, 3481
Bse3DI GCAATG 1 cut(s) 93
Bse8I GATNNNNATC 2 cut(s) 233, 2102
BseAI TCCGGA 2 cut(s) 606, 2475
BseJI GATNNNNATC 2 cut(s) 233, 2102
BseMI GCAATG 1 cut(s) 93
BseNI ACTGG 4 cut(s) 254, 1612, 2123, 3481
BseSI GKGCMC 3 cut(s) 108, 1878, 3747
BseX3I CGGCCG 2 cut(s) 382, 2251
BseYI CCCAGC 4 cut(s) 340, 1672, 2209, 3541
BshNI GGYRCC 6 cut(s) 272, 1645, 1875, 2141, 3514, 3744
BsiHKAI GWGCWC 7 cut(s) 108, 653, 1742, 1958, 2522, 3611, 3827
BsiHKCI CYCGRG 3 cut(s) 129, 1912, 3781
BsiWI CGTACG 3 cut(s) 87, 1605, 3474
BslFI GGGAC 2 cut(s) 1615, 3484
BsmFI GGGAC 2 cut(s) 1615, 3484
BsoBI CYCGRG 3 cut(s) 129, 1912, 3781
Bsp13I TCCGGA 2 cut(s) 606, 2475
Bsp1720I GCTNAGC 2 cut(s) 461, 2330
Bsp68I TCGCGA 2 cut(s) 1709, 3578
BspEI TCCGGA 2 cut(s) 606, 2475
BspMAI CTGCAG 2 cut(s) 584, 2453
BspT107I GGYRCC 6 cut(s) 272, 1645, 1875, 2141, 3514, 3744
BsrBI CCGCTC 4 cut(s) 1416, 1804, 3285, 3673
BsrDI GCAATG 1 cut(s) 93
BsrFI RCCGGY 6 cut(s) 384, 1825, 1982, 2253, 3694, 3851
BsrI ACTGG 4 cut(s) 254, 1612, 2123, 3481
BssAI RCCGGY 6 cut(s) 384, 1825, 1982, 2253, 3694, 3851
BssSI CACGAG 2 cut(s) 1924, 3793
Bst2BI CACGAG 2 cut(s) 1924, 3793
Bst4CI ACNGT 4 cut(s) 489, 1791, 2358, 3660
BstBAI YACGTR 5 cut(s) 162, 1531, 1618, 3400, 3487
BstH2I RGCGCY 3 cut(s) 362, 419, 2288
BstNSI RCATGY 4 cut(s) 349, 445, 2218, 2314
BstSFI CTRYAG 6 cut(s) 580, 1465, 1787, 2449, 3334, 3656
BstSLI GKGCMC 3 cut(s) 108, 1878, 3747
BstX2I RGATCY 8 cut(s) 234, 603, 1399, 1418, 2103, 2472, 3268, 3287
BstXI CCANNNNNNTGG 2 cut(s) 775, 2644
BstYI RGATCY 8 cut(s) 234, 603, 1399, 1418, 2103, 2472, 3268, 3287
BstZI CGGCCG 2 cut(s) 382, 2251
BtrI CACGTC 2 cut(s) 268, 2137
BtsIMutI CAGTG 2 cut(s) 247, 2116
BtuMI TCGCGA 2 cut(s) 1709, 3578
Cfr10I RCCGGY 6 cut(s) 384, 1825, 1982, 2253, 3694, 3851
Cfr42I CCGCGG 6 cut(s) 515, 1476, 1628, 2384, 3345, 3497
Cfr9I CCCGGG 3 cut(s) 129, 1912, 3781
CpoI CGGWCCG 2 cut(s) 2024, 3893
CspI CGGWCCG 2 cut(s) 2024, 3893
DrdI GACNNNNNNGTC 2 cut(s) 266, 2135
DseDI GACNNNNNNGTC 2 cut(s) 266, 2135
EaeI YGGCCR 7 cut(s) 145, 382, 386, 1494, 2251, 2255, 3363
EagI CGGCCG 2 cut(s) 382, 2251
Ecl136II GAGCTC 4 cut(s) 651, 1740, 2520, 3609
EclXI CGGCCG 2 cut(s) 382, 2251
Eco24I GRGCYC 6 cut(s) 653, 1742, 2042, 2522, 3611, 3911
Eco52I CGGCCG 2 cut(s) 382, 2251
Eco53kI GAGCTC 4 cut(s) 651, 1740, 2520, 3609
Eco57I CTGAAG 2 cut(s) 1915, 3784
Eco88I CYCGRG 3 cut(s) 129, 1912, 3781
EcoICRI GAGCTC 4 cut(s) 651, 1740, 2520, 3609
EcoO109I RGGNCCY 4 cut(s) 1566, 1755, 3435, 3624
EcoT38I GRGCYC 6 cut(s) 653, 1742, 2042, 2522, 3611, 3911
FaqI GGGAC 2 cut(s) 1615, 3484
FauI CCCGC 6 cut(s) 516, 656, 1996, 2385, 2525, 3865
FblI GTMKAC 1 cut(s) 125
FriOI GRGCYC 6 cut(s) 653, 1742, 2042, 2522, 3611, 3911
FseI GGCCGGCC 2 cut(s) 388, 2257
FspBI CTAG 1 cut(s) 29
FspI TGCGCA 2 cut(s) 437, 2306
GsaI CCCAGC 4 cut(s) 344, 1676, 2213, 3545
GsuI CTGGAG 4 cut(s) 347, 1820, 2216, 3689
HaeII RGCGCY 3 cut(s) 362, 419, 2288
HincII GTYRAC 3 cut(s) 126, 540, 2409
HindII GTYRAC 3 cut(s) 126, 540, 2409
HphI GGTGA 4 cut(s) 325, 1450, 2194, 3319
Hpy188III TCNNGA 9 cut(s) 29, 232, 607, 1594, 1708, 2101, 2476, 3463, 3577
HpyCH4III ACNGT 4 cut(s) 489, 1791, 2358, 3660
HpyCH4V TGCA 6 cut(s) 98, 106, 205, 582, 2074, 2451
Kpn2I TCCGGA 2 cut(s) 606, 2475
KroI GCCGGC 2 cut(s) 384, 2253
KroNI GCCGGC 2 cut(s) 386, 2255
KspI CCGCGG 6 cut(s) 515, 1476, 1628, 2384, 3345, 3497
LweI GCATC 4 cut(s) 476, 1377, 2345, 3246
MaeI CTAG 1 cut(s) 29
MaeIII GTNAC 8 cut(s) 575, 1541, 1618, 1934, 2444, 3410, 3487, 3803
MbiI CCGCTC 4 cut(s) 1416, 1804, 3285, 3673
MboII GAAGA 2 cut(s) 2008, 3877
MflI RGATCY 8 cut(s) 234, 603, 1399, 1418, 2103, 2472, 3268, 3287
MluCI AATT 4 cut(s) 617, 791, 2486, 2660
MlyI GAGTC 6 cut(s) 526, 541, 1673, 2395, 2410, 3542
MroI TCCGGA 2 cut(s) 606, 2475
MroNI GCCGGC 2 cut(s) 384, 2253
MseI TTAA 6 cut(s) 491, 719, 794, 2360, 2588, 2663
MslI CAYNNNNRTG 4 cut(s) 311, 410, 2180, 2279
NaeI GCCGGC 2 cut(s) 386, 2255
NgoMIV GCCGGC 2 cut(s) 384, 2253
NmuCI GTSAC 4 cut(s) 575, 1618, 2444, 3487
NruI TCGCGA 2 cut(s) 1709, 3578
NsbI TGCGCA 2 cut(s) 437, 2306
NspI RCATGY 4 cut(s) 349, 445, 2218, 2314
OliI CACNNNNGTG 2 cut(s) 311, 2180
PaeI GCATGC 4 cut(s) 349, 445, 2218, 2314
PasI CCCWGGG 2 cut(s) 1556, 3425
PcsI WCGNNNNNNNCGW 9 cut(s) 174, 1508, 1614, 1839, 1856, 3377, 3483, 3708, 3725
PdiI GCCGGC 2 cut(s) 386, 2255
PfeI GAWTC 4 cut(s) 1636, 2053, 3505, 3922
Pfl23II CGTACG 3 cut(s) 87, 1605, 3474
PflFI GACNNNGTC 2 cut(s) 1663, 3532
PflMI CCANNNNNTGG 1 cut(s) 99
Ple19I CGATCG 4 cut(s) 1707, 1837, 3576, 3706
PleI GAGTC 6 cut(s) 525, 540, 1672, 2394, 2409, 3541
PpsI GAGTC 6 cut(s) 525, 540, 1672, 2394, 2409, 3541
Ppu21I YACGTR 5 cut(s) 162, 1531, 1618, 3400, 3487
PpuMI RGGWCCY 2 cut(s) 1566, 3435
Psp124BI GAGCTC 4 cut(s) 653, 1742, 2522, 3611
Psp1406I AACGTT 2 cut(s) 542, 2411
Psp5II RGGWCCY 2 cut(s) 1566, 3435
PspFI CCCAGC 4 cut(s) 340, 1672, 2209, 3541
PspLI CGTACG 3 cut(s) 87, 1605, 3474
PspPPI RGGWCCY 2 cut(s) 1566, 3435
PstI CTGCAG 2 cut(s) 584, 2453
PsuI RGATCY 8 cut(s) 234, 603, 1399, 1418, 2103, 2472, 3268, 3287
PsyI GACNNNGTC 2 cut(s) 1663, 3532
PvuI CGATCG 4 cut(s) 1707, 1837, 3576, 3706
PvuII CAGCTG 2 cut(s) 340, 2209
RgaI GCGATCGC 2 cut(s) 1707, 3576
RigI GGCCGGCC 2 cut(s) 388, 2257
RruI TCGCGA 2 cut(s) 1709, 3578
RseI CAYNNNNRTG 4 cut(s) 311, 410, 2180, 2279
Rsr2I CGGWCCG 2 cut(s) 2024, 3893
RsrII CGGWCCG 2 cut(s) 2024, 3893
SacI GAGCTC 4 cut(s) 653, 1742, 2522, 3611
SacII CCGCGG 6 cut(s) 515, 1476, 1628, 2384, 3345, 3497
SalI GTCGAC 1 cut(s) 124
SaqAI TTAA 6 cut(s) 491, 719, 794, 2360, 2588, 2663
SchI GAGTC 6 cut(s) 526, 541, 1673, 2395, 2410, 3542
SfaAI GCGATCGC 2 cut(s) 1707, 3576
SfaNI GCATC 4 cut(s) 476, 1377, 2345, 3246
SfcI CTRYAG 6 cut(s) 580, 1465, 1787, 2449, 3334, 3656
Sfr303I CCGCGG 6 cut(s) 515, 1476, 1628, 2384, 3345, 3497
SgfI GCGATCGC 2 cut(s) 1707, 3576
SgrAI CRCCGGYG 2 cut(s) 1825, 3694
SgrBI CCGCGG 6 cut(s) 515, 1476, 1628, 2384, 3345, 3497
SmaI CCCGGG 3 cut(s) 131, 1914, 3783
SmiMI CAYNNNNRTG 4 cut(s) 311, 410, 2180, 2279
SphI GCATGC 4 cut(s) 349, 445, 2218, 2314
Sse9I AATT 4 cut(s) 617, 791, 2486, 2660
SspMI CTAG 1 cut(s) 29
SstI GAGCTC 4 cut(s) 653, 1742, 2522, 3611
TaaI ACNGT 4 cut(s) 489, 1791, 2358, 3660
TasI AATT 4 cut(s) 617, 791, 2486, 2660
TfiI GAWTC 4 cut(s) 1636, 2053, 3505, 3922
Tru1I TTAA 6 cut(s) 491, 719, 794, 2360, 2588, 2663
Tru9I TTAA 6 cut(s) 491, 719, 794, 2360, 2588, 2663
TscAI CASTG 2 cut(s) 254, 2123
TseFI GTSAC 4 cut(s) 575, 1618, 2444, 3487
Tsp45I GTSAC 4 cut(s) 575, 1618, 2444, 3487
TspMI CCCGGG 3 cut(s) 129, 1912, 3781
TspRI CASTG 2 cut(s) 254, 2123
Tth111I GACNNNGTC 2 cut(s) 1663, 3532
Van91I CCANNNNNTGG 1 cut(s) 99
VneI GTGCAC 1 cut(s) 104
XapI RAATTY 2 cut(s) 617, 2486
XbaI TCTAGA 1 cut(s) 28
XceI RCATGY 4 cut(s) 349, 445, 2218, 2314
XmaI CCCGGG 3 cut(s) 129, 1912, 3781
XmiI GTMKAC 1 cut(s) 125
XspI CTAG 1 cut(s) 29
ZraI GACGTC 4 cut(s) 262, 673, 2131, 2542
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.