Rmu_sc0003385.1_g000003

Belongs to the 'GDSL' lipolytic enzyme family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003385.1
OG0019032
Physical Location & Seq
Forward (+)
13779 .. 14624
846 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003385.1_g000003.1.cds

Sequence Viewer

Length: 489 bp
atgccaagtttccgaaatgggtgcaatttcgcagctggaggggctgctacacttccggcaactgcaacatctgtctgccccttttcatttgggattcaggtctcccagtttttgcaattcaaagtccaggcttttcaattgctagctgccaaaggtaaggaacttgagaattatctaccctcagaagattcctttcagaaggggctttacgtgtttgatataggccaaaatgatcttgctggtgcattttattctaaagcactggatcagattctttcttttattccaacaattttgtcaaagtttgaatcaggaataaaggtcagttcagcaacattaaacattgaagattttgtttcagtgttaatatctgaagtaggaatgacattgaagtttcatcctgtgcttattttctccagagattatatggatcaaggtgcttggaacttttggatacacaacaaaggtcctcttgggtggtcgacttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00901 ko01110 map00901 map01110
Pfam Domains
Protein Families
Lipase_GDSL

Protein Analysis

162

Amino Acids

17.81

Weight (kDa)

5.59

Isoelectric Point (pI)

41.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019032)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0231861 RchiOBHm_Chr7g0231981
rosa_multiflora Rmu_sc0003385.1_g000003
rosa_samantha Rh1BG185100 Rh1DG073400 Rh1DG214900 Rh5CG209300 Rh6CG200000 Rh7BG397200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 482
AclWI GGATC 2 cut(s) 273, 438
AcuI CTGAAG 1 cut(s) 393
AflIII ACRYGT 1 cut(s) 210
AgsI TTSAA 5 cut(s) 121, 137, 308, 347, 391
AjnI CCWGG 1 cut(s) 126
AluBI AGCT 2 cut(s) 35, 146
AluI AGCT 2 cut(s) 35, 146
Alw26I GTCTC 1 cut(s) 106
AlwI GGATC 2 cut(s) 273, 438
AoxI GGCC 1 cut(s) 223
ApeKI GCWGC 3 cut(s) 32, 44, 146
AspS9I GGNCC 1 cut(s) 467
AsuNHI GCTAGC 1 cut(s) 142
AvaII GGWCC 1 cut(s) 467
BarI GAAGNNNNNNTAC 2 cut(s) 191, 223
BbvI GCAGC 3 cut(s) 31, 44, 133
BcgI CGANNNNNNTGC 1 cut(s) 37
BciT130I CCWGG 1 cut(s) 128
BciVI GTATCC 1 cut(s) 447
BcoDI GTCTC 1 cut(s) 106
BfaI CTAG 1 cut(s) 143
BfuI GTATCC 1 cut(s) 447
BisI GCNGC 3 cut(s) 33, 45, 147
BlsI GCNGC 3 cut(s) 34, 46, 148
Bme1390I CCNGG 1 cut(s) 128
Bme18I GGWCC 1 cut(s) 467
BmgT120I GGNCC 1 cut(s) 467
BmrFI CCNGG 1 cut(s) 128
BmrI ACTGGG 1 cut(s) 100
BmtI GCTAGC 1 cut(s) 146
BmuI ACTGGG 1 cut(s) 100
BpmI CTGGAG 2 cut(s) 57, 400
BpuEI CTTGAG 1 cut(s) 185
BsaAI YACGTR 1 cut(s) 211
BsaI GGTCTC 1 cut(s) 106
Bse1I ACTGG 2 cut(s) 106, 267
BseBI CCWGG 1 cut(s) 128
BseGI GGATG 1 cut(s) 397
BseMII CTCAG 1 cut(s) 195
BseNI ACTGG 2 cut(s) 106, 267
BseXI GCAGC 3 cut(s) 31, 44, 133
BshFI GGCC 1 cut(s) 225
BsiSI CCGG 1 cut(s) 56
BsmAI GTCTC 1 cut(s) 106
BsnI GGCC 1 cut(s) 225
Bso31I GGTCTC 1 cut(s) 106
Bsp143I GATC 3 cut(s) 232, 265, 430
BspANI GGCC 1 cut(s) 225
BspCNI CTCAG 1 cut(s) 194
BspOI GCTAGC 1 cut(s) 146
BspPI GGATC 2 cut(s) 273, 438
BspTNI GGTCTC 1 cut(s) 106
BsrI ACTGG 2 cut(s) 106, 267
BssMI GATC 3 cut(s) 232, 265, 430
Bst2UI CCWGG 1 cut(s) 128
BstBAI YACGTR 1 cut(s) 211
BstC8I GCNNGC 1 cut(s) 144
BstDEI CTNAG 2 cut(s) 181, 486
BstF5I GGATG 1 cut(s) 397
BstKTI GATC 3 cut(s) 235, 268, 433
BstMAI GTCTC 1 cut(s) 106
BstMBI GATC 3 cut(s) 232, 265, 430
BstMWI GCNNNNNNNGC 1 cut(s) 41
BstNI CCWGG 1 cut(s) 128
BstSCI CCNGG 1 cut(s) 126
BstV1I GCAGC 3 cut(s) 31, 44, 133
BsuI GTATCC 1 cut(s) 447
BsuRI GGCC 1 cut(s) 225
BtsCI GGATG 1 cut(s) 397
BtsIMutI CAGTG 2 cut(s) 260, 366
Cac8I GCNNGC 1 cut(s) 144
Cfr13I GGNCC 1 cut(s) 467
CviJI RGCY 6 cut(s) 35, 44, 131, 146, 205, 225
CviKI_1 RGCY 6 cut(s) 35, 44, 131, 146, 205, 225
DdeI CTNAG 2 cut(s) 181, 486
DpnI GATC 3 cut(s) 234, 267, 432
DpnII GATC 3 cut(s) 232, 265, 430
Eco31I GGTCTC 1 cut(s) 106
Eco47I GGWCC 1 cut(s) 467
Eco57I CTGAAG 1 cut(s) 393
EcoO109I RGGNCCY 1 cut(s) 467
EcoRII CCWGG 1 cut(s) 126
FaiI YATR 3 cut(s) 221, 426, 428
FalI AAGNNNNNCTT 2 cut(s) 456, 488
FblI GTMKAC 1 cut(s) 482
Fnu4HI GCNGC 3 cut(s) 33, 45, 147
FokI GGATG 1 cut(s) 384
Fsp4HI GCNGC 3 cut(s) 33, 45, 147
FspBI CTAG 1 cut(s) 143
GluI GCNGC 3 cut(s) 33, 45, 147
GsuI CTGGAG 2 cut(s) 57, 400
HaeIII GGCC 1 cut(s) 225
HapII CCGG 1 cut(s) 56
HincII GTYRAC 1 cut(s) 483
HindII GTYRAC 1 cut(s) 483
HinfI GANTC 4 cut(s) 94, 188, 271, 308
HpaII CCGG 1 cut(s) 56
Hpy166II GTNNAC 1 cut(s) 483
Hpy188I TCNGA 5 cut(s) 14, 184, 198, 270, 373
Hpy188III TCNNGA 2 cut(s) 312, 417
Hpy8I GTNNAC 1 cut(s) 483
HpyAV CCTTC 1 cut(s) 193
HpyCH4IV ACGT 1 cut(s) 210
HpyCH4V TGCA 4 cut(s) 24, 65, 115, 245
HpyF10VI GCNNNNNNNGC 1 cut(s) 41
HpyF3I CTNAG 2 cut(s) 181, 486
HpySE526I ACGT 1 cut(s) 210
Kzo9I GATC 3 cut(s) 232, 265, 430
Lsp1109I GCAGC 3 cut(s) 31, 44, 133
MaeI CTAG 1 cut(s) 143
MaeII ACGT 1 cut(s) 210
MalI GATC 3 cut(s) 234, 267, 432
MboI GATC 3 cut(s) 232, 265, 430
MboII GAAGA 2 cut(s) 197, 359
MfeI CAATTG 1 cut(s) 137
MluCI AATT 5 cut(s) 25, 116, 137, 169, 291
MmeI TCCRAC 1 cut(s) 311
MnlI CCTC 3 cut(s) 32, 190, 480
MseI TTAA 2 cut(s) 338, 365
MspA1I CMGCKG 1 cut(s) 35
MspI CCGG 1 cut(s) 56
MspR9I CCNGG 1 cut(s) 128
MunI CAATTG 1 cut(s) 137
MvaI CCWGG 1 cut(s) 128
MwoI GCNNNNNNNGC 1 cut(s) 41
NdeII GATC 3 cut(s) 232, 265, 430
NheI GCTAGC 1 cut(s) 142
PfeI GAWTC 4 cut(s) 94, 188, 271, 308
PkrI GCNGC 3 cut(s) 34, 46, 148
Ppu21I YACGTR 1 cut(s) 211
PpuMI RGGWCCY 1 cut(s) 467
Psp5II RGGWCCY 1 cut(s) 467
Psp6I CCWGG 1 cut(s) 126
PspGI CCWGG 1 cut(s) 126
PspPI GGNCC 1 cut(s) 467
PspPPI RGGWCCY 1 cut(s) 467
PvuII CAGCTG 1 cut(s) 35
SalI GTCGAC 1 cut(s) 481
SaqAI TTAA 2 cut(s) 338, 365
SatI GCNGC 3 cut(s) 33, 45, 147
Sau3AI GATC 3 cut(s) 232, 265, 430
Sau96I GGNCC 1 cut(s) 467
ScrFI CCNGG 1 cut(s) 128
SetI ASST 8 cut(s) 37, 102, 148, 157, 213, 324, 439, 469
SinI GGWCC 1 cut(s) 467
SmlI CTYRAG 1 cut(s) 164
SmoI CTYRAG 1 cut(s) 164
Sse9I AATT 5 cut(s) 25, 116, 137, 169, 291
SspMI CTAG 1 cut(s) 143
StyD4I CCNGG 1 cut(s) 126
TaiI ACGT 1 cut(s) 213
TaqI TCGA 1 cut(s) 482
TasI AATT 5 cut(s) 25, 116, 137, 169, 291
TfiI GAWTC 4 cut(s) 94, 188, 271, 308
Tru1I TTAA 2 cut(s) 338, 365
Tru9I TTAA 2 cut(s) 338, 365
TscAI CASTG 2 cut(s) 267, 366
TseI GCWGC 3 cut(s) 32, 44, 146
TspDTI ATGAA 2 cut(s) 75, 386
TspRI CASTG 2 cut(s) 267, 366
VpaK11BI GGWCC 1 cut(s) 467
XcmI CCANNNNNNNNNTGG 1 cut(s) 424
XmiI GTMKAC 1 cut(s) 482
XspI CTAG 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.