Rmu_sc0003543.1_g000003

Seed dormancy control

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003543.1
OG0012547
Physical Location & Seq
Reverse (-)
7717 .. 9576
1860 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003543.1_g000003.1.cds

Sequence Viewer

Length: 894 bp
atgcttcagaaaaaagaagcagcagcgatgaaggggatggtgccatctcagccctccatgaaatacccagatgaagatgatgaacatgaagtgaaagaaggaaatgtggggttgccagtagaaggtggttttgcaattgaggacatttctgaaaagtttcagtctcagtgcatcagcctttacaagcgagacctctcaaaacgaggtgaagagctcacttttgagaagaatggcgtgtggaggcaagagcagaagggcagaactgcaaggctggagaaacagctcaggttgaggtgggaacttgaggagataattgaagaacaagtgaacaggttccatgcacactacaacttggatatggtcccaacccgcctcaaagacatttcccaactcctcatgcccaattggactccacctgatgagcttgcctccataggttggtttggtgattggcggccctcttccattctggaacttgtgcggtgcttgtctgcttcctgctttccaatctctgctagcacagaccacctcttactgcagctcattcatgagattcggatcgaagaggcaatacttgatgaggagatggctgagattcagtctacatgtatcctctaccttccgtttgctccaatcaacattcaatcaggtggatctgccttggcttgtgttcactctgagttcaagaagattgaaagggttatcacaaaagctcagcaactcaggttcaaggcactggaattggttttgaagaagatactgaatgaaattgatgcagcagagttcttagtggcatttgagggaatacaagatgctattcaccagtttgcagcaaaccagaggttccagaagggtccagttgctatgcctgtcaaggctttggggtctgcctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DOG1

Protein Analysis

297

Amino Acids

33.76

Weight (kDa)

5.34

Isoelectric Point (pI)

63.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012547)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G15320 AT1G15320
fragaria_vesca FvH4_6g29541
malus_domestica MD17G1213300.v1.1
prunus_persica Prupe.3G088600_v2.0.a1 Prupe.3G088600_v2.0.a1
pyrus_communis pycom17g21820
rosa_chinensis RchiOBHm_Chr2g0135091
rosa_laevigata RLG00000019441
rosa_multiflora Rmu_co8282347.1_g000001 Rmu_sc0001385.1_g000014 Rmu_sc0003543.1_g000003
rosa_roxburghii Rroxscaffold_2G00109490
rosa_rugosa Rorug02G0322700
rosa_samantha Rh2AG371900 Rh2BG379600 Rh2CG358700 Rh2DG396200
rosa_wichuraiana Rw0G013560

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 40
AccB7I CCANNNNNTGG 1 cut(s) 438
AccI GTMKAC 1 cut(s) 602
AciI CCGC 3 cut(s) 370, 454, 481
AclWI GGATC 2 cut(s) 566, 661
AfiI CCNNNNNNNGG 2 cut(s) 122, 438
AflIII ACRYGT 1 cut(s) 605
AgsI TTSAA 6 cut(s) 317, 644, 685, 695, 730, 751
AluBI AGCT 5 cut(s) 214, 283, 424, 541, 713
AluI AGCT 5 cut(s) 214, 283, 424, 541, 713
Alw21I GWGCWC 1 cut(s) 216
Alw26I GTCTC 2 cut(s) 168, 183
AlwI GGATC 2 cut(s) 566, 661
AoxI GGCC 1 cut(s) 455
ApeKI GCWGC 5 cut(s) 20, 23, 538, 776, 830
Asp700I GAANNNNTTC 2 cut(s) 156, 332
AspS9I GGNCC 3 cut(s) 361, 456, 854
AsuHPI GGTGA 3 cut(s) 218, 458, 812
AsuNHI GCTAGC 1 cut(s) 515
AvaII GGWCC 2 cut(s) 361, 854
BanI GGYRCC 1 cut(s) 40
BanII GRGCYC 1 cut(s) 216
BarI GAAGNNNNNNTAC 2 cut(s) 555, 587
Bbv12I GWGCWC 1 cut(s) 216
BbvI GCAGC 5 cut(s) 32, 35, 550, 788, 842
BccI CCATC 3 cut(s) 31, 52, 580
BciVI GTATCC 1 cut(s) 620
BcoDI GTCTC 2 cut(s) 168, 183
BfaI CTAG 1 cut(s) 516
BfmI CTRYAG 1 cut(s) 536
BfuI GTATCC 1 cut(s) 620
BisI GCNGC 6 cut(s) 21, 24, 455, 539, 777, 831
BlpI GCTNAGC 1 cut(s) 714
BlsI GCNGC 6 cut(s) 22, 25, 456, 540, 778, 832
Bme18I GGWCC 2 cut(s) 361, 854
BmgT120I GGNCC 3 cut(s) 361, 456, 854
BmiI GGNNCC 5 cut(s) 42, 335, 363, 845, 855
BmsI GCATC 3 cut(s) 180, 763, 802
BmtI GCTAGC 1 cut(s) 519
BplI GAGNNNNNCTC 2 cut(s) 413, 445
BpmI CTGGAG 1 cut(s) 293
Bpu10I CCTNAGC 1 cut(s) 284
Bpu1102I GCTNAGC 1 cut(s) 714
BpuEI CTTGAG 1 cut(s) 323
BsaBI GATNNNNATC 1 cut(s) 557
BsaI GGTCTC 1 cut(s) 183
BsaJI CCNNGG 1 cut(s) 660
Bsc4I CCNNNNNNNGG 2 cut(s) 122, 438
Bse1I ACTGG 4 cut(s) 116, 741, 823, 857
Bse8I GATNNNNATC 1 cut(s) 557
BseDI CCNNGG 1 cut(s) 660
BseGI GGATG 1 cut(s) 42
BseJI GATNNNNATC 1 cut(s) 557
BseLI CCNNNNNNNGG 2 cut(s) 122, 438
BseMII CTCAG 7 cut(s) 62, 179, 298, 582, 669, 728, 736
BseNI ACTGG 4 cut(s) 116, 741, 823, 857
BseRI GAGGAG 3 cut(s) 320, 383, 596
BseXI GCAGC 5 cut(s) 32, 35, 550, 788, 842
BshFI GGCC 1 cut(s) 457
BshNI GGYRCC 1 cut(s) 40
BsiHKAI GWGCWC 1 cut(s) 216
BslFI GGGAC 1 cut(s) 347
BslI CCNNNNNNNGG 2 cut(s) 122, 438
BsmAI GTCTC 2 cut(s) 168, 183
BsmFI GGGAC 1 cut(s) 347
BsnI GGCC 1 cut(s) 457
Bso31I GGTCTC 1 cut(s) 183
Bsp1286I GDGCHC 1 cut(s) 216
Bsp143I GATC 2 cut(s) 558, 653
Bsp1720I GCTNAGC 1 cut(s) 714
BspACI CCGC 3 cut(s) 370, 454, 481
BspANI GGCC 1 cut(s) 457
BspCNI CTCAG 7 cut(s) 61, 178, 297, 583, 670, 727, 735
BspHI TCATGA 1 cut(s) 547
BspLI GGNNCC 5 cut(s) 42, 335, 363, 845, 855
BspMAI CTGCAG 1 cut(s) 540
BspOI GCTAGC 1 cut(s) 519
BspPI GGATC 2 cut(s) 566, 661
BspQI GCTCTTC 1 cut(s) 204
BspT107I GGYRCC 1 cut(s) 40
BspTNI GGTCTC 1 cut(s) 183
BsrI ACTGG 4 cut(s) 116, 741, 823, 857
BssECI CCNNGG 1 cut(s) 660
BssMI GATC 2 cut(s) 558, 653
BssT1I CCWWGG 1 cut(s) 660
Bst6I CTCTTC 3 cut(s) 204, 466, 558
BstC8I GCNNGC 2 cut(s) 426, 517
BstDEI CTNAG 8 cut(s) 48, 165, 284, 591, 678, 714, 722, 787
BstF5I GGATG 1 cut(s) 42
BstKTI GATC 2 cut(s) 561, 656
BstMAI GTCTC 2 cut(s) 168, 183
BstMBI GATC 2 cut(s) 558, 653
BstMWI GCNNNNNNNGC 1 cut(s) 49
BstNSI RCATGY 1 cut(s) 609
BstSFI CTRYAG 1 cut(s) 536
BstV1I GCAGC 5 cut(s) 32, 35, 550, 788, 842
BstX2I RGATCY 1 cut(s) 653
BstYI RGATCY 1 cut(s) 653
BsuI GTATCC 1 cut(s) 620
BsuRI GGCC 1 cut(s) 457
BtgZI GCGATG 1 cut(s) 41
BtsCI GGATG 1 cut(s) 42
BtsIMutI CAGTG 2 cut(s) 173, 734
Cac8I GCNNGC 2 cut(s) 426, 517
CciI TCATGA 1 cut(s) 547
Cfr13I GGNCC 3 cut(s) 361, 456, 854
CviAII CATG 6 cut(s) 58, 86, 338, 397, 548, 606
DdeI CTNAG 8 cut(s) 48, 165, 284, 591, 678, 714, 722, 787
DpnI GATC 2 cut(s) 560, 655
DpnII GATC 2 cut(s) 558, 653
Eam1104I CTCTTC 3 cut(s) 204, 466, 558
EarI CTCTTC 3 cut(s) 204, 466, 558
Ecl136II GAGCTC 1 cut(s) 214
Eco130I CCWWGG 1 cut(s) 660
Eco24I GRGCYC 1 cut(s) 216
Eco31I GGTCTC 1 cut(s) 183
Eco47I GGWCC 2 cut(s) 361, 854
Eco53kI GAGCTC 1 cut(s) 214
EcoICRI GAGCTC 1 cut(s) 214
EcoT14I CCWWGG 1 cut(s) 660
EcoT38I GRGCYC 1 cut(s) 216
ErhI CCWWGG 1 cut(s) 660
FaeI CATG 6 cut(s) 61, 89, 341, 400, 551, 609
FaiI YATR 9 cut(s) 59, 87, 339, 359, 398, 434, 549, 607, 866
FaqI GGGAC 1 cut(s) 347
FatI CATG 6 cut(s) 57, 85, 337, 396, 547, 605
FauI CCCGC 1 cut(s) 377
FblI GTMKAC 1 cut(s) 602
Fnu4HI GCNGC 6 cut(s) 21, 24, 455, 539, 777, 831
FokI GGATG 1 cut(s) 49
FriOI GRGCYC 1 cut(s) 216
Fsp4HI GCNGC 6 cut(s) 21, 24, 455, 539, 777, 831
FspBI CTAG 1 cut(s) 516
GluI GCNGC 6 cut(s) 21, 24, 455, 539, 777, 831
GsuI CTGGAG 1 cut(s) 293
HaeIII GGCC 1 cut(s) 457
Hin1II CATG 6 cut(s) 61, 89, 341, 400, 551, 609
HinfI GANTC 3 cut(s) 409, 553, 595
HphI GGTGA 3 cut(s) 218, 458, 812
Hpy166II GTNNAC 3 cut(s) 328, 603, 673
Hpy188I TCNGA 4 cut(s) 9, 151, 558, 679
Hpy188III TCNNGA 4 cut(s) 470, 548, 685, 847
Hpy8I GTNNAC 3 cut(s) 328, 603, 673
HpyAV CCTTC 6 cut(s) 25, 92, 116, 247, 629, 844
HpyCH4V TGCA 7 cut(s) 134, 171, 266, 341, 538, 776, 830
HpyF10VI GCNNNNNNNGC 1 cut(s) 49
HpyF3I CTNAG 8 cut(s) 48, 165, 284, 591, 678, 714, 722, 787
Hsp92II CATG 6 cut(s) 61, 89, 341, 400, 551, 609
Kzo9I GATC 2 cut(s) 558, 653
LguI GCTCTTC 1 cut(s) 204
LmnI GCTCC 1 cut(s) 634
Lsp1109I GCAGC 5 cut(s) 32, 35, 550, 788, 842
LweI GCATC 3 cut(s) 180, 763, 802
MaeI CTAG 1 cut(s) 516
MalI GATC 2 cut(s) 560, 655
MboI GATC 2 cut(s) 558, 653
MboII GAAGA 9 cut(s) 86, 221, 238, 329, 453, 575, 700, 763, 766
MfeI CAATTG 2 cut(s) 135, 403
MflI RGATCY 1 cut(s) 653
MhlI GDGCHC 1 cut(s) 216
MluCI AATT 5 cut(s) 135, 312, 403, 740, 768
MlyI GAGTC 1 cut(s) 403
MroXI GAANNNNTTC 2 cut(s) 156, 332
MunI CAATTG 2 cut(s) 135, 403
MwoI GCNNNNNNNGC 1 cut(s) 49
NdeII GATC 2 cut(s) 558, 653
NheI GCTAGC 1 cut(s) 515
NlaIII CATG 6 cut(s) 61, 89, 341, 400, 551, 609
NlaIV GGNNCC 5 cut(s) 42, 335, 363, 845, 855
NspI RCATGY 1 cut(s) 609
PagI TCATGA 1 cut(s) 547
PciI ACATGT 1 cut(s) 605
PciSI GCTCTTC 1 cut(s) 204
PdmI GAANNNNTTC 2 cut(s) 156, 332
PfeI GAWTC 2 cut(s) 553, 595
PflMI CCANNNNNTGG 1 cut(s) 438
PkrI GCNGC 6 cut(s) 22, 25, 456, 540, 778, 832
PleI GAGTC 1 cut(s) 403
PpsI GAGTC 1 cut(s) 403
PscI ACATGT 1 cut(s) 605
Psp124BI GAGCTC 1 cut(s) 216
PspN4I GGNNCC 5 cut(s) 42, 335, 363, 845, 855
PspPI GGNCC 3 cut(s) 361, 456, 854
PstI CTGCAG 1 cut(s) 540
PsuI RGATCY 1 cut(s) 653
SacI GAGCTC 1 cut(s) 216
SapI GCTCTTC 1 cut(s) 204
SatI GCNGC 6 cut(s) 21, 24, 455, 539, 777, 831
Sau3AI GATC 2 cut(s) 558, 653
Sau96I GGNCC 3 cut(s) 361, 456, 854
SchI GAGTC 1 cut(s) 403
SduI GDGCHC 1 cut(s) 216
SfaNI GCATC 3 cut(s) 180, 763, 802
SfcI CTRYAG 1 cut(s) 536
SinI GGWCC 2 cut(s) 361, 854
SmlI CTYRAG 1 cut(s) 302
SmoI CTYRAG 1 cut(s) 302
Sse9I AATT 5 cut(s) 135, 312, 403, 740, 768
SsiI CCGC 3 cut(s) 370, 454, 481
SspMI CTAG 1 cut(s) 516
SstI GAGCTC 1 cut(s) 216
StyI CCWWGG 1 cut(s) 660
TaqI TCGA 1 cut(s) 561
TasI AATT 5 cut(s) 135, 312, 403, 740, 768
TauI GCSGC 1 cut(s) 457
TfiI GAWTC 2 cut(s) 553, 595
TscAI CASTG 2 cut(s) 173, 741
TseI GCWGC 5 cut(s) 20, 23, 538, 776, 830
TspDTI ATGAA 7 cut(s) 44, 74, 87, 96, 102, 536, 780
TspGWI ACGGA 1 cut(s) 612
TspRI CASTG 2 cut(s) 173, 741
Van91I CCANNNNNTGG 1 cut(s) 438
VpaK11BI GGWCC 2 cut(s) 361, 854
XceI RCATGY 1 cut(s) 609
XmiI GTMKAC 1 cut(s) 602
XmnI GAANNNNTTC 2 cut(s) 156, 332
XspI CTAG 1 cut(s) 516
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.