Rmu_sc0004279.1_g000006

Abnormal spindle-like microcephaly-associated protein homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004279.1
Physical Location & Seq
Forward (+)
19577 .. 27535
7959 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004279.1_g000006.1.cds

Sequence Viewer

Length: 3732 bp
atggacggcgcggaaccgccgttatgtccgtcaccgtgtccgtacaaaccgccgtccactctcttcaaagacatctccaatttcaaaaccccaaaacgcccctccaaaatctccaatttccactccccctgcccccaattcttcaccgcctccaaacacaccccccggacaaactcgtcctttcgccgccggccgtcgattgctccgtccaactctgctcggaccaaagccgccgtccgcagactcaaggccgtagagctcgagcagtcacagtcctcccgcaaggtccaaatccgaaaggagcagtccctcaaatctctcgcgaaatctctcaccgtctggctcaatttcctcttcgaaaaccctaggtcctgcggctgtaattttccggtcgatgaggatcacagtcaaacgctccggaaggggaagagggacagcgggtcgggcgttgaggttcgggtagacgcggcgtggagggacccgaagcggcagagagactcgtcgtggaaaggtgaagattccgaaagtgccggtgcgttttcgagctctaagtactcgaaattgcagtgttctttgaagctcttgtgtagttttgatgatttggttcagcgaatgcggttttatttgagtttggggagttgcaaggaggttttcgattcgatgattcaagtagccaagagtattgatgaagggaggttaaagatgaaggtgcattgccctttagtgactgatgttggactgagaaagaaggccactaaagtccttatgagttataatccaatctggcttcgaattggattgtacgttatatttgggggtgactctttgttgtcagaccgagaagttaactctgatgaggaagtcgcatttttgaaaatgattattgagaagcaactgtttgcacatactggtctagcgaaagagtatgcttataacaagaaggttgagggtctttaccgaccgggttattatgaagctttgggaaatgtcatattgaagaggtttctgttgcttgttcttattctggatagagctaaatctcaaagcagtctttctcttaagtatggtcttgatggagtggatggaggttctcctttattgtttatggtacagtctagtatcaaatcaagtcatcaggtgatccatgattttttgtcatctgatatcatgcttggagaaggtaacgtctcagcacatctggtgattttaggatataaagtatctcatcaacagtctccgatcgtggattttgactttcgagttacagatttatttgttgatcttcaagacgggttgcgcctctgtagagcgattcagcttctgaaggatgactcatctatcctaatgaaaatggctgttccatcagatacacataaaaagcacctggcaaattgtggcactgccctgcagtatcttaaggaggctggtgttgttttacatgatgatgatggaatgatgattgtagaagatgatattgctgatggggagaaggaacttactatttccttgctttggaatatgtttgttcatttgcagctacctcttttggtcaagaaaacagcattagctgaggaaatatgcaatattcgaggaaatatggatagcttcattaatgctgattctcctccactggaactgcttttaaattggattcaggcaatttgtgaaatttatgattgcaagatcgacagtttttcttcattggtggatggaaaagccatatggtgcctgctggattatcacttccgtaagcaactttgttgtacttggtcatcgaaggatcctaataaatcaagtcacgaagaatcaatcatgttagccaccgaatattcagatgccgtgcacaactttttattatcacagaaattgatgtcactattgggaaactttccagaggttctgcaaataagtgacattcttgagtataatggtgtacctaatgatcgtagtgtggtgatcctgttggtgttcctttcatctcaactgattgggaagaaaaacatgggtcaattgaactttcataaactattaggctgtgattgtcaaagttcagagcgaatatgctctgtaagacctgaaccagcacagatccaaaaagaaacacgcattcagcgtactgaaggttctgtgaaaaactttaaggctatccaggcttggtggcgagatatggctgaaaggaaccataaacttccaaaaccattagctcctactttgcagaacttctctacaaacgaagatgaaattaacatttcaagagccactatcattcaatcttatgtacgtggatgggttgcccgaagagaagctgatcaacataggcatctcattgttactatccaaagatactgccgtggttggttgagaaggaggtatttcttatgccaaagaatagctgtagtgaagatccaaagtgctattcgatgcctactatactgtcaggcatttcaacgtcatagacaagctgcagtggaaattcaacggatagtcagggggaagattagtcgaagtaatctcttaggtgcttcatgtctacaccctgtcatcccccatggttgtcttttaaagatcacgagtgccttctatagtagtgtcgaactaaatatagtgttctgctctgtgttgaaattgcaaaggtggtggaggagtgtcctgtcgctaaaactaagaacaaagtctgcggtacttattcagtctcatattcgagagtggtttgctaggcaaaaggcttctagagagaggcattgtagtgttgtgatacaatcatactggagaggccaccaggcacggaaaaaagagtcgagggaacagctaaaactaagaacaaagtctgcagtacttattcagtctcatattcgagaatggcttgctaggcaacagggttctagagagagccattgtagtgttgtgatacaatcatactggagaggctaccaggcacggaaaaaagagtcaagggaacagctaaaactaagaacaaaagctgctgtacttattcagtctcatgttcgagaatggtttgctaggcaaaaaaaggcttctagagagaggcattgtagtgttgtgatacaatcatactggagaggctaccaggcacggaaaaaagagtcaagggaacagctcaaggatttacgcttgagagtgcagaaatcttctactagtgtggacgatagcatgcgtattatcaacagacttgttgctgcactttcagagctactaagaatgaaaagtatcagcaacattcttcatacttgtgccactttggatatggctacaaggtattctcaaaaatgttgtgaaagactcgtggatgctggagctatcaaaactttgctgaagctcattcgctcaggcagccgaagtatacccgatcaggaggttctaaagcacgcactgtcaactctaagaaaccttgctcgctatccacacttggttgaagtactaattgattgtgaagggtctgtagaaactgttctctgggagttgctaaggaacaaggaagaaggttatttcattgcttctgaacttctgaagaagatatgctctagtcataaaggtgctgaagctgtacgcaagtcacctgcccatttgaaaaggctgcgcagtcttgtggaggaacttggaaggaagtcatgcaatgagaagaggaatgcccgattcgcaaatgctagagagaatacagagagaagactaaaggaggctgttgtgattctgaaaatggcaacagaaagttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

1243

Amino Acids

142.13

Weight (kDa)

9.61

Isoelectric Point (pI)

49.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 774, 933
AarI CACCTGC 1 cut(s) 3586
AasI GACNNNNNNGTC 1 cut(s) 175
Acc16I TGCGCA 1 cut(s) 3599
Acc36I ACCTGC 1 cut(s) 3586
AccB1I GGYRCC 1 cut(s) 1725
AccI GTMKAC 3 cut(s) 462, 2530, 3361
AccII CGCG 3 cut(s) 11, 323, 467
AccIII TCCGGA 1 cut(s) 417
AclWI GGATC 7 cut(s) 408, 1135, 1775, 1788, 1951, 2083, 2398
AcoI YGGCCR 1 cut(s) 191
AcsI RAATTY 2 cut(s) 1668, 2472
AcuI CTGAAG 5 cut(s) 1343, 2139, 3353, 3548, 3579
AfiI CCNNNNNNNGG 1 cut(s) 1512
AflII CTTAAG 2 cut(s) 1058, 1415
AhdI GACNNNNNGTC 1 cut(s) 439
AhlI ACTAGT 1 cut(s) 3155
AjnI CCWGG 5 cut(s) 1383, 2148, 2778, 2931, 3087
AjuI GAANNNNNNNTTGG 2 cut(s) 2400, 2432
Alw21I GWGCWC 3 cut(s) 261, 548, 1845
Alw26I GTCTC 6 cut(s) 489, 1192, 1239, 2697, 2850, 3003
Alw44I GTGCAC 1 cut(s) 1841
AlwI GGATC 7 cut(s) 408, 1135, 1775, 1788, 1951, 2083, 2398
AlwNI CAGNNNCTG 1 cut(s) 1321
Ama87I CYCGRG 1 cut(s) 260
Aor13HI TCCGGA 1 cut(s) 417
AoxI GGCC 4 cut(s) 191, 249, 750, 2773
ApaLI GTGCAC 1 cut(s) 1841
ApeKI GCWGC 6 cut(s) 1534, 2462, 2981, 3197, 3351, 3595
ApoI RAATTY 2 cut(s) 1668, 2472
ArsI GACNNNNNNTTYG 2 cut(s) 219, 251
AseI ATTAAT 1 cut(s) 1611
Asp700I GAANNNNTTC 1 cut(s) 3468
AspA2I CCTAGG 1 cut(s) 365
AspLEI GCGC 3 cut(s) 11, 1299, 3600
AspS9I GGNCC 4 cut(s) 222, 286, 369, 478
AsuC2I CCSGG 2 cut(s) 166, 963
AsuHPI GGTGA 9 cut(s) 24, 136, 325, 524, 830, 1150, 1213, 1966, 3567
AsuII TTCGAA 2 cut(s) 357, 790
AvaI CYCGRG 1 cut(s) 260
AvaII GGWCC 4 cut(s) 222, 286, 369, 478
AvrII CCTAGG 1 cut(s) 365
BaeGI GKGCMC 1 cut(s) 1845
BaeI ACNNNNGTAYC 2 cut(s) 2335, 2368
BamHI GGATCC 1 cut(s) 1780
BanI GGYRCC 1 cut(s) 1725
BanII GRGCYC 2 cut(s) 261, 548
BauI CACGAG 2 cut(s) 2569, 3302
BbsI GAAGAC 1 cut(s) 3691
Bbv12I GWGCWC 3 cut(s) 261, 548, 1845
BbvCI CCTCAGC 1 cut(s) 1569
BbvI GCAGC 6 cut(s) 1546, 2449, 2968, 3184, 3363, 3582
BccI CCATC 7 cut(s) 1067, 1076, 1369, 1442, 1475, 1703, 2280
BceAI ACGGC 8 cut(s) 4, 22, 37, 178, 218, 236, 1823, 2334
BciT130I CCWGG 5 cut(s) 1385, 2150, 2780, 2933, 3089
BclI TGATCA 1 cut(s) 2308
BcnI CCSGG 2 cut(s) 166, 963
BcoDI GTCTC 6 cut(s) 489, 1192, 1239, 2697, 2850, 3003
BcuI ACTAGT 1 cut(s) 3155
BfmI CTRYAG 7 cut(s) 1303, 1406, 2394, 2463, 2581, 2829, 3459
BfrI CTTAAG 2 cut(s) 1058, 1415
BfuAI ACCTGC 1 cut(s) 3586
BlnI CCTAGG 1 cut(s) 365
BmcAI AGTACT 3 cut(s) 554, 2835, 3438
Bme1390I CCNGG 7 cut(s) 166, 963, 1385, 2150, 2780, 2933, 3089
Bme18I GGWCC 4 cut(s) 222, 286, 369, 478
BmeRI GACNNNNNGTC 1 cut(s) 439
BmeT110I CYCGRG 1 cut(s) 260
BmgT120I GGNCC 4 cut(s) 222, 286, 369, 478
BmiI GGNNCC 6 cut(s) 15, 479, 480, 1727, 1782, 2180
BmrFI CCNGG 7 cut(s) 166, 963, 1385, 2150, 2780, 2933, 3089
BmsI GCATC 4 cut(s) 1825, 2329, 2411, 3298
BpiI GAAGAC 1 cut(s) 3691
BpmI CTGGAG 4 cut(s) 2788, 2941, 3097, 3333
Bpu10I CCTNAGC 3 cut(s) 1569, 3346, 3485
Bpu14I TTCGAA 2 cut(s) 357, 790
BpuEI CTTGAG 4 cut(s) 230, 1940, 3104, 3154
BpuMI CCSGG 2 cut(s) 166, 963
BsaAI YACGTR 1 cut(s) 2282
BsaBI GATNNNNATC 1 cut(s) 399
BsaJI CCNNGG 4 cut(s) 164, 365, 2350, 2548
BsaWI WCCGGW 2 cut(s) 388, 417
Bsc4I CCNNNNNNNGG 1 cut(s) 1512
Bse118I RCCGGY 2 cut(s) 189, 530
Bse1I ACTGG 5 cut(s) 913, 1635, 2771, 2924, 3080
Bse3DI GCAATG 3 cut(s) 712, 3510, 3640
Bse8I GATNNNNATC 1 cut(s) 399
BseAI TCCGGA 1 cut(s) 417
BseBI CCWGG 5 cut(s) 1385, 2150, 2780, 2933, 3089
BseDI CCNNGG 4 cut(s) 164, 365, 2350, 2548
BseGI GGATG 6 cut(s) 1087, 1333, 1714, 2291, 2541, 3313
BseJI GATNNNNATC 1 cut(s) 399
BseLI CCNNNNNNNGG 1 cut(s) 1512
BseMI GCAATG 3 cut(s) 712, 3510, 3640
BseMII CTCAG 4 cut(s) 731, 1203, 1560, 3360
BseNI ACTGG 5 cut(s) 913, 1635, 2771, 2924, 3080
BseRI GAGGAG 2 cut(s) 1614, 2656
BseSI GKGCMC 1 cut(s) 1845
BseX3I CGGCCG 1 cut(s) 191
BseXI GCAGC 6 cut(s) 1546, 2449, 2968, 3184, 3363, 3582
BsgI GTGCAG 2 cut(s) 3161, 3183
Bsh1236I CGCG 3 cut(s) 11, 323, 467
Bsh1285I CGRYCG 4 cut(s) 194, 393, 962, 1242
BshFI GGCC 4 cut(s) 193, 251, 752, 2775
BshNI GGYRCC 1 cut(s) 1725
BsiEI CGRYCG 4 cut(s) 194, 393, 962, 1242
BsiHKAI GWGCWC 3 cut(s) 261, 548, 1845
BsiHKCI CYCGRG 1 cut(s) 260
BsiSI CCGG 6 cut(s) 166, 190, 389, 418, 531, 962
BslFI GGGAC 3 cut(s) 292, 446, 491
BslI CCNNNNNNNGG 1 cut(s) 1512
BsmAI GTCTC 6 cut(s) 489, 1192, 1239, 2697, 2850, 3003
BsmBI CGTCTC 1 cut(s) 1192
BsmFI GGGAC 3 cut(s) 292, 446, 491
BsmI GAATGC 3 cut(s) 618, 2106, 3652
BsnI GGCC 4 cut(s) 193, 251, 752, 2775
BsoBI CYCGRG 1 cut(s) 260
Bsp119I TTCGAA 2 cut(s) 357, 790
Bsp1286I GDGCHC 3 cut(s) 261, 548, 1845
Bsp13I TCCGGA 1 cut(s) 417
Bsp19I CCATGG 1 cut(s) 2548
Bsp68I TCGCGA 1 cut(s) 323
BspANI GGCC 4 cut(s) 193, 251, 752, 2775
BspCNI CTCAG 4 cut(s) 732, 1202, 1561, 3359
BspEI TCCGGA 1 cut(s) 417
BspFNI CGCG 3 cut(s) 11, 323, 467
BspLI GGNNCC 6 cut(s) 15, 479, 480, 1727, 1782, 2180
BspMAI CTGCAG 3 cut(s) 1410, 2467, 2833
BspMI ACCTGC 1 cut(s) 3586
BspPI GGATC 7 cut(s) 408, 1135, 1775, 1788, 1951, 2083, 2398
BspT104I TTCGAA 2 cut(s) 357, 790
BspT107I GGYRCC 1 cut(s) 1725
BspTI CTTAAG 2 cut(s) 1058, 1415
BsrDI GCAATG 3 cut(s) 712, 3510, 3640
BsrFI RCCGGY 2 cut(s) 189, 530
BsrI ACTGG 5 cut(s) 913, 1635, 2771, 2924, 3080
BssAI RCCGGY 2 cut(s) 189, 530
BssECI CCNNGG 4 cut(s) 164, 365, 2350, 2548
BssNAI GTATAC 1 cut(s) 3362
BssSI CACGAG 2 cut(s) 2569, 3302
BssT1I CCWWGG 2 cut(s) 365, 2548
Bst1107I GTATAC 1 cut(s) 3362
Bst2BI CACGAG 2 cut(s) 2569, 3302
Bst2UI CCWGG 5 cut(s) 1385, 2150, 2780, 2933, 3089
Bst6I CTCTTC 6 cut(s) 68, 359, 422, 992, 2293, 3635
BstAFI CTTAAG 2 cut(s) 1058, 1415
BstBAI YACGTR 1 cut(s) 2282
BstBI TTCGAA 2 cut(s) 357, 790
BstC8I GCNNGC 6 cut(s) 191, 1730, 2865, 3173, 3387, 3415
BstDSI CCRYGG 2 cut(s) 2350, 2548
BstF5I GGATG 6 cut(s) 1087, 1333, 1714, 2291, 2541, 3313
BstFNI CGCG 3 cut(s) 11, 323, 467
BstHHI GCGC 3 cut(s) 11, 1299, 3600
BstMAI GTCTC 6 cut(s) 489, 1192, 1239, 2697, 2850, 3003
BstMCI CGRYCG 4 cut(s) 194, 393, 962, 1242
BstMWI GCNNNNNNNGC 5 cut(s) 444, 2150, 2869, 3351, 3656
BstNI CCWGG 5 cut(s) 1385, 2150, 2780, 2933, 3089
BstNSI RCATGY 1 cut(s) 3175
BstSCI CCNGG 7 cut(s) 164, 961, 1383, 2148, 2778, 2931, 3087
BstSFI CTRYAG 7 cut(s) 1303, 1406, 2394, 2463, 2581, 2829, 3459
BstSLI GKGCMC 1 cut(s) 1845
BstUI CGCG 3 cut(s) 11, 323, 467
BstV1I GCAGC 6 cut(s) 1546, 2449, 2968, 3184, 3363, 3582
BstV2I GAAGAC 1 cut(s) 3691
BstX2I RGATCY 3 cut(s) 1780, 2088, 2403
BstYI RGATCY 3 cut(s) 1780, 2088, 2403
BstZ17I GTATAC 1 cut(s) 3362
BstZI CGGCCG 1 cut(s) 191
BsuRI GGCC 4 cut(s) 193, 251, 752, 2775
BtgI CCRYGG 2 cut(s) 2350, 2548
BtsCI GGATG 6 cut(s) 1087, 1333, 1714, 2291, 2541, 3313
BtsI GCAGTG 3 cut(s) 572, 1398, 2472
BtsIMutI CAGTG 5 cut(s) 572, 1398, 1628, 2472, 3389
BtuMI TCGCGA 1 cut(s) 323
BveI ACCTGC 1 cut(s) 3586
Cac8I GCNNGC 6 cut(s) 191, 1730, 2865, 3173, 3387, 3415
CaiI CAGNNNCTG 1 cut(s) 1321
CfoI GCGC 3 cut(s) 11, 1299, 3600
Cfr10I RCCGGY 2 cut(s) 189, 530
Cfr13I GGNCC 4 cut(s) 222, 286, 369, 478
CseI GACGC 1 cut(s) 473
CspCI CAANNNNNGTGG 2 cut(s) 2618, 2653
DraI TTTAAA 2 cut(s) 1644, 2562
DrdI GACNNNNNNGTC 1 cut(s) 175
DriI GACNNNNNGTC 1 cut(s) 439
DseDI GACNNNNNNGTC 1 cut(s) 175
EaeI YGGCCR 1 cut(s) 191
EagI CGGCCG 1 cut(s) 191
Eam1104I CTCTTC 6 cut(s) 68, 359, 422, 992, 2293, 3635
Eam1105I GACNNNNNGTC 1 cut(s) 439
EarI CTCTTC 6 cut(s) 68, 359, 422, 992, 2293, 3635
Ecl136II GAGCTC 2 cut(s) 259, 546
EclXI CGGCCG 1 cut(s) 191
Eco130I CCWWGG 2 cut(s) 365, 2548
Eco24I GRGCYC 2 cut(s) 261, 548
Eco32I GATATC 1 cut(s) 1165
Eco47I GGWCC 4 cut(s) 222, 286, 369, 478
Eco52I CGGCCG 1 cut(s) 191
Eco53kI GAGCTC 2 cut(s) 259, 546
Eco57I CTGAAG 5 cut(s) 1343, 2139, 3353, 3548, 3579
Eco88I CYCGRG 1 cut(s) 260
EcoICRI GAGCTC 2 cut(s) 259, 546
EcoO109I RGGNCCY 2 cut(s) 369, 478
EcoRII CCWGG 5 cut(s) 1383, 2148, 2778, 2931, 3087
EcoRV GATATC 1 cut(s) 1165
EcoT14I CCWWGG 2 cut(s) 365, 2548
EcoT38I GRGCYC 2 cut(s) 261, 548
ErhI CCWWGG 2 cut(s) 365, 2548
Esp3I CGTCTC 1 cut(s) 1192
FaqI GGGAC 3 cut(s) 292, 446, 491
FauI CCCGC 2 cut(s) 287, 431
FauNDI CATATG 1 cut(s) 1721
FbaI TGATCA 1 cut(s) 2308
FblI GTMKAC 3 cut(s) 462, 2530, 3361
FokI GGATG 6 cut(s) 1094, 1340, 1721, 2298, 2528, 3320
FriOI GRGCYC 2 cut(s) 261, 548
FspI TGCGCA 1 cut(s) 3599
GlaI GCGC 3 cut(s) 10, 1298, 3599
GsuI CTGGAG 4 cut(s) 2788, 2941, 3097, 3333
HaeIII GGCC 4 cut(s) 193, 251, 752, 2775
HapII CCGG 6 cut(s) 166, 190, 389, 418, 531, 962
HgaI GACGC 1 cut(s) 473
HhaI GCGC 3 cut(s) 11, 1299, 3600
Hin6I GCGC 3 cut(s) 9, 1297, 3598
HinP1I GCGC 3 cut(s) 9, 1297, 3598
HincII GTYRAC 2 cut(s) 847, 3396
HindII GTYRAC 2 cut(s) 847, 3396
HindIII AAGCTT 1 cut(s) 975
HpaI GTTAAC 1 cut(s) 847
HpaII CCGG 6 cut(s) 166, 190, 389, 418, 531, 962
HphI GGTGA 9 cut(s) 24, 136, 325, 524, 830, 1150, 1213, 1966, 3567
Hpy166II GTNNAC 9 cut(s) 57, 463, 847, 1843, 1934, 2531, 3163, 3362, 3396
Hpy8I GTNNAC 9 cut(s) 57, 463, 847, 1843, 1934, 2531, 3163, 3362, 3396
Hpy99I CGWCG 2 cut(s) 199, 505
HpyCH4IV ACGT 4 cut(s) 804, 1185, 2281, 2449
HpyF10VI GCNNNNNNNGC 5 cut(s) 444, 2150, 2869, 3351, 3656
HpySE526I ACGT 4 cut(s) 804, 1185, 2281, 2449
HspAI GCGC 3 cut(s) 9, 1297, 3598
KflI GGGWCCC 1 cut(s) 478
Kpn2I TCCGGA 1 cut(s) 417
KroI GCCGGC 1 cut(s) 189
KroNI GCCGGC 1 cut(s) 191
Ksp22I TGATCA 1 cut(s) 2308
KspAI GTTAAC 1 cut(s) 847
LmnI GCTCC 5 cut(s) 208, 301, 420, 2209, 3314
Lsp1109I GCAGC 6 cut(s) 1546, 2449, 2968, 3184, 3363, 3582
LweI GCATC 4 cut(s) 1825, 2329, 2411, 3298
MaeII ACGT 4 cut(s) 804, 1185, 2281, 2449
MfeI CAATTG 1 cut(s) 2009
MflI RGATCY 3 cut(s) 1780, 2088, 2403
MhlI GDGCHC 3 cut(s) 261, 548, 1845
MlyI GAGTC 8 cut(s) 237, 491, 815, 1325, 2804, 2957, 3113, 3294
MmeI TCCRAC 2 cut(s) 234, 715
MroI TCCGGA 1 cut(s) 417
MroNI GCCGGC 1 cut(s) 189
MroXI GAANNNNTTC 1 cut(s) 3468
MseI TTAA 9 cut(s) 698, 846, 1059, 1416, 1611, 1643, 2139, 2244, 2561
MslI CAYNNNNRTG 6 cut(s) 1443, 2745, 2898, 3054, 3249, 3552
MspA1I CMGCKG 1 cut(s) 438
MspCI CTTAAG 2 cut(s) 1058, 1415
MspI CCGG 6 cut(s) 166, 190, 389, 418, 531, 962
MspR9I CCNGG 7 cut(s) 166, 963, 1385, 2150, 2780, 2933, 3089
MunI CAATTG 1 cut(s) 2009
Mva1269I GAATGC 3 cut(s) 618, 2106, 3652
MvaI CCWGG 5 cut(s) 1385, 2150, 2780, 2933, 3089
MvnI CGCG 3 cut(s) 11, 323, 467
MwoI GCNNNNNNNGC 5 cut(s) 444, 2150, 2869, 3351, 3656
NaeI GCCGGC 1 cut(s) 191
NciI CCSGG 2 cut(s) 166, 963
NcoI CCATGG 1 cut(s) 2548
NdeI CATATG 1 cut(s) 1721
NgoMIV GCCGGC 1 cut(s) 189
NlaIV GGNNCC 6 cut(s) 15, 479, 480, 1727, 1782, 2180
NmuCI GTSAC 8 cut(s) 30, 267, 724, 818, 1796, 1872, 1910, 3573
NruI TCGCGA 1 cut(s) 323
NsbI TGCGCA 1 cut(s) 3599
NspI RCATGY 1 cut(s) 3175
NspV TTCGAA 2 cut(s) 357, 790
PaeI GCATGC 1 cut(s) 3175
PaeR7I CTCGAG 1 cut(s) 260
PaqCI CACCTGC 1 cut(s) 3586
PcsI WCGNNNNNNNCGW 2 cut(s) 203, 2110
PctI GAATGC 3 cut(s) 618, 2106, 3652
PdiI GCCGGC 1 cut(s) 191
PdmI GAANNNNTTC 1 cut(s) 3468
PfeI GAWTC 9 cut(s) 518, 656, 664, 1312, 1619, 1651, 1805, 3654, 3706
Ple19I CGATCG 1 cut(s) 1242
PleI GAGTC 8 cut(s) 237, 491, 815, 1325, 2803, 2956, 3112, 3294
PpsI GAGTC 8 cut(s) 237, 491, 815, 1325, 2803, 2956, 3112, 3294
Ppu21I YACGTR 1 cut(s) 2282
PpuMI RGGWCCY 2 cut(s) 369, 478
PshBI ATTAAT 1 cut(s) 1611
PsiI TTATAA 2 cut(s) 774, 933
Psp124BI GAGCTC 2 cut(s) 261, 548
Psp5II RGGWCCY 2 cut(s) 369, 478
Psp6I CCWGG 5 cut(s) 1383, 2148, 2778, 2931, 3087
PspGI CCWGG 5 cut(s) 1383, 2148, 2778, 2931, 3087
PspN4I GGNNCC 6 cut(s) 15, 479, 480, 1727, 1782, 2180
PspPI GGNCC 4 cut(s) 222, 286, 369, 478
PspPPI RGGWCCY 2 cut(s) 369, 478
PspXI VCTCGAGB 1 cut(s) 260
PsrI GAACNNNNNNTAC 4 cut(s) 2107, 2139, 3453, 3485
PstI CTGCAG 3 cut(s) 1410, 2467, 2833
PstNI CAGNNNCTG 1 cut(s) 1321
PsuI RGATCY 3 cut(s) 1780, 2088, 2403
PvuI CGATCG 1 cut(s) 1242
RruI TCGCGA 1 cut(s) 323
RseI CAYNNNNRTG 6 cut(s) 1443, 2745, 2898, 3054, 3249, 3552
SacI GAGCTC 2 cut(s) 261, 548
SaqAI TTAA 9 cut(s) 698, 846, 1059, 1416, 1611, 1643, 2139, 2244, 2561
Sau96I GGNCC 4 cut(s) 222, 286, 369, 478
ScaI AGTACT 3 cut(s) 554, 2835, 3438
SchI GAGTC 8 cut(s) 237, 491, 815, 1325, 2804, 2957, 3113, 3294
ScrFI CCNGG 7 cut(s) 166, 963, 1385, 2150, 2780, 2933, 3089
SduI GDGCHC 3 cut(s) 261, 548, 1845
SfaNI GCATC 4 cut(s) 1825, 2329, 2411, 3298
SfcI CTRYAG 7 cut(s) 1303, 1406, 2394, 2463, 2581, 2829, 3459
Sfr274I CTCGAG 1 cut(s) 260
SfuI TTCGAA 2 cut(s) 357, 790
SinI GGWCC 4 cut(s) 222, 286, 369, 478
SlaI CTCGAG 1 cut(s) 260
SmiMI CAYNNNNRTG 6 cut(s) 1443, 2745, 2898, 3054, 3249, 3552
SmlI CTYRAG 7 cut(s) 245, 260, 1058, 1415, 1919, 3119, 3133
SmoI CTYRAG 7 cut(s) 245, 260, 1058, 1415, 1919, 3119, 3133
SpeI ACTAGT 1 cut(s) 3155
SphI GCATGC 1 cut(s) 3175
SspI AATATT 2 cut(s) 1585, 1829
SstI GAGCTC 2 cut(s) 261, 548
StyD4I CCNGG 7 cut(s) 164, 961, 1383, 2148, 2778, 2931, 3087
StyI CCWWGG 2 cut(s) 365, 2548
TaiI ACGT 4 cut(s) 807, 1188, 2284, 2452
TaqII GACCGA 1 cut(s) 852
TatI WGTACW 5 cut(s) 552, 1763, 2833, 2986, 3436
TauI GCSGC 5 cut(s) 189, 233, 378, 470, 490
TfiI GAWTC 9 cut(s) 518, 656, 664, 1312, 1619, 1651, 1805, 3654, 3706
Tru1I TTAA 9 cut(s) 698, 846, 1059, 1416, 1611, 1643, 2139, 2244, 2561
Tru9I TTAA 9 cut(s) 698, 846, 1059, 1416, 1611, 1643, 2139, 2244, 2561
TscAI CASTG 5 cut(s) 572, 1405, 1635, 2472, 3396
TseFI GTSAC 8 cut(s) 30, 267, 724, 818, 1796, 1872, 1910, 3573
TseI GCWGC 6 cut(s) 1534, 2462, 2981, 3197, 3351, 3595
Tsp45I GTSAC 8 cut(s) 30, 267, 724, 818, 1796, 1872, 1910, 3573
TspGWI ACGGA 8 cut(s) 18, 30, 195, 1736, 2494, 2800, 2953, 3109
TspRI CASTG 5 cut(s) 572, 1405, 1635, 2472, 3396
Vha464I CTTAAG 2 cut(s) 1058, 1415
VneI GTGCAC 1 cut(s) 1841
VpaK11BI GGWCC 4 cut(s) 222, 286, 369, 478
VspI ATTAAT 1 cut(s) 1611
XapI RAATTY 2 cut(s) 1668, 2472
XbaI TCTAGA 3 cut(s) 2729, 2882, 3038
XceI RCATGY 1 cut(s) 3175
XcmI CCANNNNNNNNNTGG 1 cut(s) 3262
XhoI CTCGAG 1 cut(s) 260
XmaJI CCTAGG 1 cut(s) 365
XmiI GTMKAC 3 cut(s) 462, 2530, 3361
XmnI GAANNNNTTC 1 cut(s) 3468
ZrmI AGTACT 3 cut(s) 554, 2835, 3438
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.