Rmu_sc0004350.1_g000009

Auxin-induced protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004350.1
Physical Location & Seq
Reverse (-)
37542 .. 37877
336 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004350.1_g000009.1.cds

Sequence Viewer

Length: 336 bp
atgggcattcgtgtgacagacatggtcattcatgctaggcaaattatccggagacataaaagcaggtctcattccatctcatcttattcagaaccaacatcaacggcagcattggatgttccgaaaggctattttgcggtttatgtcggagaggaagacaagaagcagaagcggtttgtgattccgatatcctacttgaaccaccctttgttccaagacttgttgaatcaggctgcagaagaattcggttttgaccctccaacgggtaacggcggacttagaataccttgcagtgaaagccactttcttgatctcactttctgtttaaatagataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

111

Amino Acids

12.58

Weight (kDa)

7.85

Isoelectric Point (pI)

48.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017723)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 54
AccIII TCCGGA 1 cut(s) 48
AciI CCGC 3 cut(s) 137, 172, 273
AcsI RAATTY 1 cut(s) 242
AfiI CCNNNNNNNGG 2 cut(s) 262, 263
AgsI TTSAA 2 cut(s) 199, 226
Alw26I GTCTC 2 cut(s) 46, 72
Aor13HI TCCGGA 1 cut(s) 48
ApeKI GCWGC 2 cut(s) 107, 233
ApoI RAATTY 1 cut(s) 242
BbsI GAAGAC 1 cut(s) 162
BbvI GCAGC 2 cut(s) 119, 220
BccI CCATC 1 cut(s) 83
BceAI ACGGC 2 cut(s) 120, 286
BcoDI GTCTC 2 cut(s) 46, 72
BfaI CTAG 1 cut(s) 36
BfmI CTRYAG 1 cut(s) 234
BfuAI ACCTGC 1 cut(s) 54
BisI GCNGC 2 cut(s) 108, 234
BlsI GCNGC 2 cut(s) 109, 235
BpiI GAAGAC 1 cut(s) 162
BsaI GGTCTC 1 cut(s) 72
BsaWI WCCGGW 1 cut(s) 48
Bsc4I CCNNNNNNNGG 2 cut(s) 262, 263
BseAI TCCGGA 1 cut(s) 48
BseGI GGATG 1 cut(s) 121
BseLI CCNNNNNNNGG 2 cut(s) 262, 263
BseXI GCAGC 2 cut(s) 119, 220
BsiSI CCGG 1 cut(s) 49
BslI CCNNNNNNNGG 2 cut(s) 262, 263
BsmAI GTCTC 2 cut(s) 46, 72
BsmI GAATGC 1 cut(s) 6
Bso31I GGTCTC 1 cut(s) 72
Bsp13I TCCGGA 1 cut(s) 48
Bsp143I GATC 1 cut(s) 310
BspACI CCGC 3 cut(s) 137, 172, 273
BspEI TCCGGA 1 cut(s) 48
BspMAI CTGCAG 1 cut(s) 238
BspMI ACCTGC 1 cut(s) 54
BspTNI GGTCTC 1 cut(s) 72
BssMI GATC 1 cut(s) 310
BstDEI CTNAG 1 cut(s) 278
BstF5I GGATG 1 cut(s) 121
BstKTI GATC 1 cut(s) 313
BstMAI GTCTC 2 cut(s) 46, 72
BstMBI GATC 1 cut(s) 310
BstMWI GCNNNNNNNGC 1 cut(s) 297
BstSFI CTRYAG 1 cut(s) 234
BstV1I GCAGC 2 cut(s) 119, 220
BstV2I GAAGAC 1 cut(s) 162
BtsCI GGATG 1 cut(s) 121
BtsI GCAGTG 1 cut(s) 298
BtsIMutI CAGTG 1 cut(s) 298
BveI ACCTGC 1 cut(s) 54
CviAII CATG 2 cut(s) 22, 32
CviJI RGCY 3 cut(s) 129, 233, 300
CviKI_1 RGCY 3 cut(s) 129, 233, 300
DdeI CTNAG 1 cut(s) 278
DpnI GATC 1 cut(s) 312
DpnII GATC 1 cut(s) 310
DraI TTTAAA 1 cut(s) 327
EciI GGCGGA 1 cut(s) 288
Eco31I GGTCTC 1 cut(s) 72
Eco32I GATATC 1 cut(s) 189
EcoRI GAATTC 1 cut(s) 242
EcoRV GATATC 1 cut(s) 189
FaeI CATG 2 cut(s) 25, 35
FaiI YATR 4 cut(s) 23, 33, 57, 144
FatI CATG 2 cut(s) 21, 31
Fnu4HI GCNGC 2 cut(s) 108, 234
FokI GGATG 1 cut(s) 128
Fsp4HI GCNGC 2 cut(s) 108, 234
FspBI CTAG 1 cut(s) 36
GluI GCNGC 2 cut(s) 108, 234
HapII CCGG 1 cut(s) 49
Hin1II CATG 2 cut(s) 25, 35
HinfI GANTC 2 cut(s) 181, 226
HpaII CCGG 1 cut(s) 49
Hpy188I TCNGA 4 cut(s) 91, 123, 149, 186
Hpy188III TCNNGA 2 cut(s) 49, 308
HpyCH4V TGCA 2 cut(s) 236, 291
HpyF10VI GCNNNNNNNGC 1 cut(s) 297
HpyF3I CTNAG 1 cut(s) 278
Hsp92II CATG 2 cut(s) 25, 35
Kpn2I TCCGGA 1 cut(s) 48
Kzo9I GATC 1 cut(s) 310
LpnPI CCDG 3 cut(s) 49, 62, 215
Lsp1109I GCAGC 2 cut(s) 119, 220
MaeI CTAG 1 cut(s) 36
MaeIII GTNAC 2 cut(s) 13, 266
MalI GATC 1 cut(s) 312
MboI GATC 1 cut(s) 310
MboII GAAGA 2 cut(s) 167, 251
MluCI AATT 2 cut(s) 42, 242
MmeI TCCRAC 2 cut(s) 127, 284
MnlI CCTC 2 cut(s) 145, 267
MroI TCCGGA 1 cut(s) 48
MseI TTAA 1 cut(s) 326
MslI CAYNNNNRTG 1 cut(s) 11
MspI CCGG 1 cut(s) 49
Mva1269I GAATGC 1 cut(s) 6
MwoI GCNNNNNNNGC 1 cut(s) 297
NdeII GATC 1 cut(s) 310
NlaIII CATG 2 cut(s) 25, 35
NmuCI GTSAC 1 cut(s) 13
PctI GAATGC 1 cut(s) 6
PfeI GAWTC 2 cut(s) 181, 226
PflFI GACNNNGTC 1 cut(s) 23
PkrI GCNGC 2 cut(s) 109, 235
PstI CTGCAG 1 cut(s) 238
PsyI GACNNNGTC 1 cut(s) 23
RseI CAYNNNNRTG 1 cut(s) 11
SaqAI TTAA 1 cut(s) 326
SatI GCNGC 2 cut(s) 108, 234
Sau3AI GATC 1 cut(s) 310
SetI ASST 2 cut(s) 68, 289
SfcI CTRYAG 1 cut(s) 234
SmiMI CAYNNNNRTG 1 cut(s) 11
Sse9I AATT 2 cut(s) 42, 242
SsiI CCGC 3 cut(s) 137, 172, 273
SspMI CTAG 1 cut(s) 36
TasI AATT 2 cut(s) 42, 242
TfiI GAWTC 2 cut(s) 181, 226
Tru1I TTAA 1 cut(s) 326
Tru9I TTAA 1 cut(s) 326
TscAI CASTG 1 cut(s) 298
TseFI GTSAC 1 cut(s) 13
TseI GCWGC 2 cut(s) 107, 233
Tsp45I GTSAC 1 cut(s) 13
TspDTI ATGAA 1 cut(s) 20
TspRI CASTG 1 cut(s) 298
Tth111I GACNNNGTC 1 cut(s) 23
XapI RAATTY 1 cut(s) 242
XspI CTAG 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.