Rmu_sc0004821.1_g000011

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004821.1
OG0016164
Physical Location & Seq
Reverse (-)
41461 .. 44395
2935 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004821.1_g000011.1.cds

Sequence Viewer

Length: 447 bp
atgaatttggggcataaagaacccggtcaaaagagatttaccaacgaggcccaacccgtaaacccattgggcttcaattcggtcaacccattcaatcaccgggggttccatcatttccacaaggttatcggtagcagatattgtttagttcttgcaatcatgagtttgagcagtgggatgaggacctgtgccaaggtcttgatgtcttcagaagcaccgttgtcgaaatcagcaactagggggttccattcaactggagtgaagaggatgggtggacatggccatgatgaaccattctacatgcattccaaacacatgtataacttggacatgatgaagcaccaggctttgaagatgagccttggagtgttcactgccttcagcattggtgtggcggttccggtatatgctgtcctattccaacagaagaaaacagcctctggttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

148

Amino Acids

16.39

Weight (kDa)

10.07

Isoelectric Point (pI)

53.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016164)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G72020
fragaria_vesca FvH4_5g38800 FvH4_5g38800
malus_domestica MD00G1104100.v1.1 MD15G1358900.v1.1
prunus_persica Prupe.1G506700_v2.0.a1 Prupe.1G506700_v2.0.a1
pyrus_communis pycom08g14850
rosa_chinensis RchiOBHm_Chr7g0240801
rosa_multiflora Rmu_sc0004821.1_g000011
rosa_roxburghii Rroxscaffold_3G00219620
rosa_rugosa Rorug07G0338800
rosa_samantha Rh7CG511700 Rh7DG478400
rosa_wichuraiana Rw7G041740

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 395
AcoI YGGCCR 1 cut(s) 280
AcsI RAATTY 1 cut(s) 4
AcuI CTGAAG 2 cut(s) 192, 364
AflIII ACRYGT 1 cut(s) 315
AgsI TTSAA 4 cut(s) 76, 94, 252, 352
AjnI CCWGG 1 cut(s) 342
AlwNI CAGNNNCTG 1 cut(s) 440
AoxI GGCC 2 cut(s) 48, 280
ApoI RAATTY 1 cut(s) 4
AspS9I GGNCC 2 cut(s) 49, 183
AsuC2I CCSGG 2 cut(s) 24, 101
AsuHPI GGTGA 1 cut(s) 89
AvaII GGWCC 1 cut(s) 183
BalI TGGCCA 1 cut(s) 282
BbsI GAAGAC 1 cut(s) 198
BccI CCATC 2 cut(s) 117, 262
BcgI CGANNNNNNTGC 2 cut(s) 204, 238
BciT130I CCWGG 1 cut(s) 344
BcnI CCSGG 2 cut(s) 24, 101
BfaI CTAG 1 cut(s) 237
Bme1390I CCNGG 3 cut(s) 24, 101, 344
Bme18I GGWCC 1 cut(s) 183
BmgT120I GGNCC 2 cut(s) 49, 183
BmiI GGNNCC 3 cut(s) 107, 245, 399
BmrFI CCNGG 3 cut(s) 24, 101, 344
BpiI GAAGAC 1 cut(s) 198
BpmI CTGGAG 1 cut(s) 276
BpuMI CCSGG 2 cut(s) 24, 101
BsaJI CCNNGG 3 cut(s) 100, 192, 361
BsaWI WCCGGW 1 cut(s) 400
Bse1I ACTGG 1 cut(s) 259
BseBI CCWGG 1 cut(s) 344
BseDI CCNNGG 3 cut(s) 100, 192, 361
BseGI GGATG 2 cut(s) 183, 273
BseNI ACTGG 1 cut(s) 259
BshFI GGCC 2 cut(s) 50, 282
BsiSI CCGG 3 cut(s) 24, 100, 401
BsmI GAATGC 1 cut(s) 304
BsnI GGCC 2 cut(s) 50, 282
BspACI CCGC 1 cut(s) 395
BspANI GGCC 2 cut(s) 50, 282
BspHI TCATGA 1 cut(s) 159
BspLI GGNNCC 3 cut(s) 107, 245, 399
BsrI ACTGG 1 cut(s) 259
BssECI CCNNGG 3 cut(s) 100, 192, 361
BssT1I CCWWGG 2 cut(s) 192, 361
Bst2UI CCWGG 1 cut(s) 344
Bst4CI ACNGT 1 cut(s) 219
Bst6I CTCTTC 1 cut(s) 257
BstF5I GGATG 2 cut(s) 183, 273
BstNI CCWGG 1 cut(s) 344
BstNSI RCATGY 2 cut(s) 304, 319
BstSCI CCNGG 3 cut(s) 22, 99, 342
BstV2I GAAGAC 1 cut(s) 198
BstXI CCANNNNNNTGG 1 cut(s) 254
BsuRI GGCC 2 cut(s) 50, 282
BtsCI GGATG 2 cut(s) 183, 273
BtsI GCAGTG 2 cut(s) 178, 372
BtsIMutI CAGTG 2 cut(s) 178, 372
CaiI CAGNNNCTG 1 cut(s) 440
CciI TCATGA 1 cut(s) 159
Cfr13I GGNCC 2 cut(s) 49, 183
CviAII CATG 6 cut(s) 160, 278, 284, 301, 316, 331
CviJI RGCY 6 cut(s) 50, 72, 282, 347, 360, 437
CviKI_1 RGCY 6 cut(s) 50, 72, 282, 347, 360, 437
EaeI YGGCCR 1 cut(s) 280
Eam1104I CTCTTC 1 cut(s) 257
EarI CTCTTC 1 cut(s) 257
Eco130I CCWWGG 2 cut(s) 192, 361
Eco47I GGWCC 1 cut(s) 183
Eco57I CTGAAG 2 cut(s) 192, 364
EcoO109I RGGNCCY 1 cut(s) 183
EcoRII CCWGG 1 cut(s) 342
EcoT14I CCWWGG 2 cut(s) 192, 361
EcoT22I ATGCAT 1 cut(s) 306
ErhI CCWWGG 2 cut(s) 192, 361
FaeI CATG 6 cut(s) 163, 281, 287, 304, 319, 334
FatI CATG 6 cut(s) 159, 277, 283, 300, 315, 330
FokI GGATG 2 cut(s) 190, 280
FspBI CTAG 1 cut(s) 237
GsuI CTGGAG 1 cut(s) 276
HaeIII GGCC 2 cut(s) 50, 282
HapII CCGG 3 cut(s) 24, 100, 401
Hin1II CATG 6 cut(s) 163, 281, 287, 304, 319, 334
HincII GTYRAC 1 cut(s) 85
HindII GTYRAC 1 cut(s) 85
HpaII CCGG 3 cut(s) 24, 100, 401
HphI GGTGA 1 cut(s) 89
Hpy166II GTNNAC 4 cut(s) 61, 85, 275, 372
Hpy188I TCNGA 1 cut(s) 211
Hpy188III TCNNGA 2 cut(s) 160, 199
Hpy8I GTNNAC 4 cut(s) 61, 85, 275, 372
HpyAV CCTTC 1 cut(s) 388
HpyCH4III ACNGT 1 cut(s) 219
HpyCH4V TGCA 2 cut(s) 155, 304
Hsp92II CATG 6 cut(s) 163, 281, 287, 304, 319, 334
LpnPI CCDG 8 cut(s) 37, 113, 199, 240, 329, 356, 414, 426
MaeI CTAG 1 cut(s) 237
MboII GAAGA 4 cut(s) 198, 274, 364, 439
MlsI TGGCCA 1 cut(s) 282
MluCI AATT 2 cut(s) 4, 76
MluNI TGGCCA 1 cut(s) 282
MmeI TCCRAC 1 cut(s) 445
MnlI CCTC 3 cut(s) 40, 174, 258
Mox20I TGGCCA 1 cut(s) 282
Mph1103I ATGCAT 1 cut(s) 306
MscI TGGCCA 1 cut(s) 282
MslI CAYNNNNRTG 2 cut(s) 282, 389
Msp20I TGGCCA 1 cut(s) 282
MspI CCGG 3 cut(s) 24, 100, 401
MspR9I CCNGG 3 cut(s) 24, 101, 344
Mva1269I GAATGC 1 cut(s) 304
MvaI CCWGG 1 cut(s) 344
NciI CCSGG 2 cut(s) 24, 101
NlaIII CATG 6 cut(s) 163, 281, 287, 304, 319, 334
NlaIV GGNNCC 3 cut(s) 107, 245, 399
NsiI ATGCAT 1 cut(s) 306
NspI RCATGY 2 cut(s) 304, 319
PagI TCATGA 1 cut(s) 159
PciI ACATGT 1 cut(s) 315
PctI GAATGC 1 cut(s) 304
PpuMI RGGWCCY 1 cut(s) 183
PscI ACATGT 1 cut(s) 315
Psp5II RGGWCCY 1 cut(s) 183
Psp6I CCWGG 1 cut(s) 342
PspGI CCWGG 1 cut(s) 342
PspN4I GGNNCC 3 cut(s) 107, 245, 399
PspPI GGNCC 2 cut(s) 49, 183
PspPPI RGGWCCY 1 cut(s) 183
PstNI CAGNNNCTG 1 cut(s) 440
RseI CAYNNNNRTG 2 cut(s) 282, 389
Sau96I GGNCC 2 cut(s) 49, 183
ScrFI CCNGG 3 cut(s) 24, 101, 344
SetI ASST 3 cut(s) 126, 188, 198
SinI GGWCC 1 cut(s) 183
SmiMI CAYNNNNRTG 2 cut(s) 282, 389
Sse9I AATT 2 cut(s) 4, 76
SsiI CCGC 1 cut(s) 395
SspMI CTAG 1 cut(s) 237
StyD4I CCNGG 3 cut(s) 22, 99, 342
StyI CCWWGG 2 cut(s) 192, 361
TaaI ACNGT 1 cut(s) 219
TaqI TCGA 1 cut(s) 224
TaqII GACCGA 1 cut(s) 70
TasI AATT 2 cut(s) 4, 76
TscAI CASTG 2 cut(s) 178, 379
TspDTI ATGAA 3 cut(s) 17, 303, 350
TspRI CASTG 2 cut(s) 178, 379
VpaK11BI GGWCC 1 cut(s) 183
XapI RAATTY 1 cut(s) 4
XceI RCATGY 2 cut(s) 304, 319
XspI CTAG 1 cut(s) 237
Zsp2I ATGCAT 1 cut(s) 306
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.