Rmu_sc0004932.1_g000001

Belongs to the BI1 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004932.1
OG0012389
Physical Location & Seq
Forward (+)
1 .. 1034
1034 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004932.1_g000001.1.cds

Sequence Viewer

Length: 479 bp
tgttgtggcccctgcatgtttaccagcaaaggcatcccctgaactttgtcttccttggacttttcactgtgagtctcagtgttactgttggtgtagcggtggcgaatactgatggagcaatagtgcttgaagcattgattctaacctctggtgtggttgcatccttgaccgcttacaccttctgggcttcgaagaagggcaaggacttcagcttccttggaccagtcttgttcactggcctcatggttctcctcttaaccagcttcatgcagatgttcttccctcttggtccaacatctaatgccgttattggtggtgtgggtgctattctcttctctgggtacatagtctatgataccgagaacctcatcaagcgctttacctatgatgagtacatctgggcctccatcacgctttatctggacattctgaacctgttccttacaatcctgaggatgctgaggtcgagcgacaattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Bax1-I

Protein Analysis

158

Amino Acids

17.52

Weight (kDa)

6.06

Isoelectric Point (pI)

22.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012389)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G15470
fragaria_vesca FvH4_4g14100
malus_domestica MD13G1179700.v1.1 MD16G1180700.v1.1
prunus_persica Prupe.1G148200_v2.0.a1 Prupe.1G148200_v2.0.a1
pyrus_communis pycom13g15490 pycom16g15180
rosa_chinensis RchiOBHm_Chr4g0419241
rosa_laevigata RLG00000007822
rosa_multiflora Rmu_sc0004932.1_g000001 Rmu_sc0019148.1_g000001
rosa_roxburghii Rroxscaffold_5G00362220
rosa_rugosa Rorug04G0157600
rosa_samantha Rh4AG219600 Rh4BG221100 Rh4CG232200 Rh4DG218600
rosa_wichuraiana Rw4G018770

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 97, 170
AcuI CTGAAG 1 cut(s) 192
AfaI GTAC 2 cut(s) 343, 394
AfeI AGCGCT 1 cut(s) 376
AgsI TTSAA 1 cut(s) 130
AluBI AGCT 2 cut(s) 212, 263
AluI AGCT 2 cut(s) 212, 263
Alw26I GTCTC 1 cut(s) 79
Aor51HI AGCGCT 1 cut(s) 376
AoxI GGCC 3 cut(s) 7, 237, 401
Asp700I GAANNNNTTC 1 cut(s) 436
AspLEI GCGC 1 cut(s) 377
AspS9I GGNCC 4 cut(s) 8, 220, 289, 401
AsuII TTCGAA 1 cut(s) 190
AvaII GGWCC 2 cut(s) 220, 289
AxyI CCTNAGG 1 cut(s) 451
BbsI GAAGAC 1 cut(s) 42
BbvCI CCTCAGC 1 cut(s) 460
BccI CCATC 2 cut(s) 106, 415
BceAI ACGGC 1 cut(s) 289
BcoDI GTCTC 1 cut(s) 79
BfoI RGCGCY 1 cut(s) 378
Bme18I GGWCC 2 cut(s) 220, 289
BmgT120I GGNCC 4 cut(s) 8, 220, 289, 401
BmiI GGNNCC 1 cut(s) 10
BmsI GCATC 3 cut(s) 42, 169, 446
BpiI GAAGAC 1 cut(s) 42
Bpu10I CCTNAGC 1 cut(s) 460
Bpu14I TTCGAA 1 cut(s) 190
BsaJI CCNNGG 2 cut(s) 54, 216
BsaXI ACNNNNNCTCC 2 cut(s) 107, 137
Bse1I ACTGG 2 cut(s) 223, 240
Bse21I CCTNAGG 1 cut(s) 451
BseDI CCNNGG 2 cut(s) 54, 216
BseGI GGATG 3 cut(s) 33, 160, 461
BseMII CTCAG 3 cut(s) 90, 442, 451
BseNI ACTGG 2 cut(s) 223, 240
BseRI GAGGAG 1 cut(s) 241
BshFI GGCC 3 cut(s) 9, 239, 403
BsmAI GTCTC 1 cut(s) 79
BsnI GGCC 3 cut(s) 9, 239, 403
Bsp119I TTCGAA 1 cut(s) 190
BspACI CCGC 2 cut(s) 97, 170
BspANI GGCC 3 cut(s) 9, 239, 403
BspCNI CTCAG 3 cut(s) 89, 443, 452
BspLI GGNNCC 1 cut(s) 10
BspT104I TTCGAA 1 cut(s) 190
BsrI ACTGG 2 cut(s) 223, 240
BssECI CCNNGG 2 cut(s) 54, 216
BssT1I CCWWGG 2 cut(s) 54, 216
Bst4CI ACNGT 2 cut(s) 69, 87
Bst6I CTCTTC 1 cut(s) 337
BstBI TTCGAA 1 cut(s) 190
BstDEI CTNAG 3 cut(s) 76, 451, 460
BstF5I GGATG 3 cut(s) 33, 160, 461
BstH2I RGCGCY 1 cut(s) 378
BstHHI GCGC 1 cut(s) 377
BstMAI GTCTC 1 cut(s) 79
BstNSI RCATGY 1 cut(s) 19
BstV2I GAAGAC 1 cut(s) 42
Bsu36I CCTNAGG 1 cut(s) 451
BsuRI GGCC 3 cut(s) 9, 239, 403
BtsCI GGATG 3 cut(s) 33, 160, 461
BtsIMutI CAGTG 3 cut(s) 65, 84, 233
CfoI GCGC 1 cut(s) 377
Cfr13I GGNCC 4 cut(s) 8, 220, 289, 401
Csp6I GTAC 2 cut(s) 342, 393
CviAII CATG 3 cut(s) 16, 243, 267
CviJI RGCY 6 cut(s) 9, 187, 212, 239, 263, 403
CviKI_1 RGCY 6 cut(s) 9, 187, 212, 239, 263, 403
CviQI GTAC 2 cut(s) 342, 393
DdeI CTNAG 3 cut(s) 76, 451, 460
Eam1104I CTCTTC 1 cut(s) 337
EarI CTCTTC 1 cut(s) 337
Eco130I CCWWGG 2 cut(s) 54, 216
Eco47I GGWCC 2 cut(s) 220, 289
Eco47III AGCGCT 1 cut(s) 376
Eco57I CTGAAG 1 cut(s) 192
Eco81I CCTNAGG 1 cut(s) 451
EcoT14I CCWWGG 2 cut(s) 54, 216
ErhI CCWWGG 2 cut(s) 54, 216
FaeI CATG 3 cut(s) 19, 246, 270
FaiI YATR 6 cut(s) 17, 244, 268, 346, 353, 386
FatI CATG 3 cut(s) 15, 242, 266
FokI GGATG 3 cut(s) 20, 147, 468
GlaI GCGC 1 cut(s) 376
HaeII RGCGCY 1 cut(s) 378
HaeIII GGCC 3 cut(s) 9, 239, 403
HhaI GCGC 1 cut(s) 377
Hin1II CATG 3 cut(s) 19, 246, 270
Hin6I GCGC 1 cut(s) 375
HinP1I GCGC 1 cut(s) 375
HinfI GANTC 2 cut(s) 72, 138
Hpy166II GTNNAC 2 cut(s) 21, 233
Hpy188I TCNGA 1 cut(s) 431
Hpy188III TCNNGA 2 cut(s) 421, 450
Hpy8I GTNNAC 2 cut(s) 21, 233
HpyAV CCTTC 2 cut(s) 189, 189
HpyCH4III ACNGT 2 cut(s) 69, 87
HpyCH4V TGCA 3 cut(s) 15, 160, 270
HpyF3I CTNAG 3 cut(s) 76, 451, 460
Hsp92II CATG 3 cut(s) 19, 246, 270
HspAI GCGC 1 cut(s) 375
LmnI GCTCC 1 cut(s) 115
LweI GCATC 3 cut(s) 42, 169, 446
MaeIII GTNAC 1 cut(s) 81
MboII GAAGA 4 cut(s) 42, 204, 270, 324
MluCI AATT 1 cut(s) 474
MlyI GAGTC 1 cut(s) 81
MmeI TCCRAC 1 cut(s) 316
MnlI CCTC 8 cut(s) 156, 250, 262, 293, 376, 414, 446, 455
MroXI GAANNNNTTC 1 cut(s) 436
MseI TTAA 1 cut(s) 256
MslI CAYNNNNRTG 1 cut(s) 271
NlaIII CATG 3 cut(s) 19, 246, 270
NlaIV GGNNCC 1 cut(s) 10
NspI RCATGY 1 cut(s) 19
NspV TTCGAA 1 cut(s) 190
PdmI GAANNNNTTC 1 cut(s) 436
PfeI GAWTC 1 cut(s) 138
PleI GAGTC 1 cut(s) 80
PpsI GAGTC 1 cut(s) 80
PspN4I GGNNCC 1 cut(s) 10
PspPI GGNCC 4 cut(s) 8, 220, 289, 401
RsaI GTAC 2 cut(s) 343, 394
RsaNI GTAC 2 cut(s) 342, 393
RseI CAYNNNNRTG 1 cut(s) 271
SaqAI TTAA 1 cut(s) 256
Sau96I GGNCC 4 cut(s) 8, 220, 289, 401
SchI GAGTC 1 cut(s) 81
SetI ASST 8 cut(s) 148, 181, 214, 265, 368, 385, 437, 466
SfaNI GCATC 3 cut(s) 42, 169, 446
SfuI TTCGAA 1 cut(s) 190
SinI GGWCC 2 cut(s) 220, 289
SmiMI CAYNNNNRTG 1 cut(s) 271
Sse9I AATT 1 cut(s) 474
SsiI CCGC 2 cut(s) 97, 170
StyI CCWWGG 2 cut(s) 54, 216
TaaI ACNGT 2 cut(s) 69, 87
TaqI TCGA 2 cut(s) 190, 466
TasI AATT 1 cut(s) 474
TatI WGTACW 1 cut(s) 392
TfiI GAWTC 1 cut(s) 138
Tru1I TTAA 1 cut(s) 256
Tru9I TTAA 1 cut(s) 256
TscAI CASTG 3 cut(s) 72, 84, 240
TspDTI ATGAA 1 cut(s) 255
TspRI CASTG 3 cut(s) 72, 84, 240
VpaK11BI GGWCC 2 cut(s) 220, 289
XceI RCATGY 1 cut(s) 19
XmnI GAANNNNTTC 1 cut(s) 436
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.