Rmu_sc0004965.1_g000007

metalloendopeptidase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004965.1
Physical Location & Seq
Forward (+)
41046 .. 42964
1919 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004965.1_g000007.1.cds

Sequence Viewer

Length: 708 bp
atggaagtgggtatgtctttgtctttaaacgcagtggttcggcttccactatcgaattcaagaacccatgaagacggtttggtcaggcactcactggtgtcctcaaaaacgaccccgaaagcttgtaagcaaagccatggccaagcactggtgattgaagcaaagggaaaaaagggaatgcaagatcgtcagttccagaggcgtcaacctcctccaatgcccaagattgaagacgatggcaacccacgttttgttgtgtttattcgaatggccaatgtttacctatggtacccacttagtgtgatctctggtggaaccaccgcaaaaatcatgcttgcagcgaaagataattttctggggaaatatatatacaaagatacacttgctagaaatcttgcagcagttatttaccgagatgagaaggaaatacagaagacggcgttcaagcagtatcgtgtattgcggtcagcgactgagtttagatatggctacaagattgtggaaaatggtaatatgagagcagcactttcaacgtcagatgtaattgagcttccaacaccagaccagcttagaaccactcttgataaagtgaaagatttttttggggaagcaaaggaatcttttggcaagctgacggctataagttcacccgagtctgaggaatcagaacaaaaaattgaaaaacccaaggaaaaggtcaaacgctga

Protein Analysis

235

Amino Acids

26.59

Weight (kDa)

9.66

Isoelectric Point (pI)

43.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011089)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 80
Acc65I GGTACC 1 cut(s) 288
AccB1I GGYRCC 1 cut(s) 288
AccB7I CCANNNNNTGG 1 cut(s) 148
AciI CCGC 2 cut(s) 321, 463
AcoI YGGCCR 2 cut(s) 139, 270
AcsI RAATTY 1 cut(s) 55
AcyI GRCGYC 1 cut(s) 202
AdeI CACNNNGTG 1 cut(s) 299
AfaI GTAC 1 cut(s) 290
AfiI CCNNNNNNNGG 1 cut(s) 148
AgsI TTSAA 6 cut(s) 60, 158, 230, 445, 531, 680
AluBI AGCT 4 cut(s) 122, 550, 568, 631
AluI AGCT 4 cut(s) 122, 550, 568, 631
AlwNI CAGNNNCTG 1 cut(s) 473
Ama87I CYCGRG 1 cut(s) 650
AoxI GGCC 2 cut(s) 139, 270
ApeKI GCWGC 3 cut(s) 338, 398, 521
ApoI RAATTY 1 cut(s) 55
Asp718I GGTACC 1 cut(s) 288
AsuHPI GGTGA 2 cut(s) 163, 639
AsuII TTCGAA 1 cut(s) 265
AvaI CYCGRG 1 cut(s) 650
BalI TGGCCA 2 cut(s) 141, 272
BanI GGYRCC 1 cut(s) 288
BarI GAAGNNNNNNTAC 2 cut(s) 534, 566
BbsI GAAGAC 3 cut(s) 78, 237, 440
BbvI GCAGC 3 cut(s) 350, 410, 533
BccI CCATC 1 cut(s) 230
BceAI ACGGC 2 cut(s) 453, 651
BfaI CTAG 1 cut(s) 387
BisI GCNGC 3 cut(s) 339, 399, 522
BlsI GCNGC 3 cut(s) 340, 400, 523
BmeT110I CYCGRG 1 cut(s) 650
BmiI GGNNCC 2 cut(s) 290, 316
BpiI GAAGAC 3 cut(s) 78, 237, 440
Bpu14I TTCGAA 1 cut(s) 265
BsaHI GRCGYC 1 cut(s) 202
BsaJI CCNNGG 2 cut(s) 136, 687
Bsc4I CCNNNNNNNGG 1 cut(s) 148
Bse1I ACTGG 2 cut(s) 99, 153
BseDI CCNNGG 2 cut(s) 136, 687
BseLI CCNNNNNNNGG 1 cut(s) 148
BseMII CTCAG 2 cut(s) 465, 648
BseNI ACTGG 2 cut(s) 99, 153
BseRI GAGGAG 1 cut(s) 201
BseXI GCAGC 3 cut(s) 350, 410, 533
BshFI GGCC 2 cut(s) 141, 272
BshNI GGYRCC 1 cut(s) 288
BsiHKCI CYCGRG 1 cut(s) 650
BslI CCNNNNNNNGG 1 cut(s) 148
BsmI GAATGC 1 cut(s) 183
BsnI GGCC 2 cut(s) 141, 272
BsoBI CYCGRG 1 cut(s) 650
Bsp119I TTCGAA 1 cut(s) 265
Bsp143I GATC 2 cut(s) 184, 303
Bsp19I CCATGG 1 cut(s) 136
BspACI CCGC 2 cut(s) 321, 463
BspANI GGCC 2 cut(s) 141, 272
BspCNI CTCAG 2 cut(s) 466, 649
BspLI GGNNCC 2 cut(s) 290, 316
BspT104I TTCGAA 1 cut(s) 265
BspT107I GGYRCC 1 cut(s) 288
BsrI ACTGG 2 cut(s) 99, 153
BssECI CCNNGG 2 cut(s) 136, 687
BssMI GATC 2 cut(s) 184, 303
BssNI GRCGYC 1 cut(s) 202
BssT1I CCWWGG 2 cut(s) 136, 687
Bst4CI ACNGT 1 cut(s) 77
BstACI GRCGYC 1 cut(s) 202
BstBI TTCGAA 1 cut(s) 265
BstC8I GCNNGC 2 cut(s) 336, 629
BstDEI CTNAG 4 cut(s) 296, 474, 569, 657
BstDSI CCRYGG 1 cut(s) 136
BstKTI GATC 2 cut(s) 187, 306
BstMBI GATC 2 cut(s) 184, 303
BstV1I GCAGC 3 cut(s) 350, 410, 533
BstV2I GAAGAC 3 cut(s) 78, 237, 440
BsuRI GGCC 2 cut(s) 141, 272
BtgI CCRYGG 1 cut(s) 136
BtsI GCAGTG 1 cut(s) 39
BtsIMutI CAGTG 3 cut(s) 39, 92, 146
Cac8I GCNNGC 2 cut(s) 336, 629
CaiI CAGNNNCTG 1 cut(s) 473
CseI GACGC 1 cut(s) 191
Csp6I GTAC 1 cut(s) 289
CviAII CATG 3 cut(s) 68, 137, 331
CviQI GTAC 1 cut(s) 289
DdeI CTNAG 4 cut(s) 296, 474, 569, 657
DpnI GATC 2 cut(s) 186, 305
DpnII GATC 2 cut(s) 184, 303
DraI TTTAAA 1 cut(s) 27
DraIII CACNNNGTG 1 cut(s) 299
DrdI GACNNNNNNGTC 1 cut(s) 80
DseDI GACNNNNNNGTC 1 cut(s) 80
EaeI YGGCCR 2 cut(s) 139, 270
Eco130I CCWWGG 2 cut(s) 136, 687
Eco88I CYCGRG 1 cut(s) 650
EcoRI GAATTC 1 cut(s) 55
EcoT14I CCWWGG 2 cut(s) 136, 687
ErhI CCWWGG 2 cut(s) 136, 687
FaeI CATG 3 cut(s) 71, 140, 334
FalI AAGNNNNNCTT 2 cut(s) 366, 398
FatI CATG 3 cut(s) 67, 136, 330
Fnu4HI GCNGC 3 cut(s) 339, 399, 522
Fsp4HI GCNGC 3 cut(s) 339, 399, 522
FspBI CTAG 1 cut(s) 387
GluI GCNGC 3 cut(s) 339, 399, 522
HaeIII GGCC 2 cut(s) 141, 272
HgaI GACGC 1 cut(s) 191
Hin1I GRCGYC 1 cut(s) 202
Hin1II CATG 3 cut(s) 71, 140, 334
HincII GTYRAC 1 cut(s) 206
HindII GTYRAC 1 cut(s) 206
HindIII AAGCTT 1 cut(s) 120
HinfI GANTC 3 cut(s) 617, 653, 662
HphI GGTGA 2 cut(s) 163, 639
Hpy166II GTNNAC 3 cut(s) 206, 280, 647
Hpy188I TCNGA 3 cut(s) 538, 658, 667
Hpy188III TCNNGA 3 cut(s) 60, 196, 581
Hpy8I GTNNAC 3 cut(s) 206, 280, 647
HpyAV CCTTC 1 cut(s) 415
HpyCH4III ACNGT 1 cut(s) 77
HpyCH4IV ACGT 2 cut(s) 247, 533
HpyCH4V TGCA 3 cut(s) 181, 338, 398
HpyF3I CTNAG 4 cut(s) 296, 474, 569, 657
HpySE526I ACGT 2 cut(s) 247, 533
Hsp92I GRCGYC 1 cut(s) 202
Hsp92II CATG 3 cut(s) 71, 140, 334
KpnI GGTACC 1 cut(s) 292
Kzo9I GATC 2 cut(s) 184, 303
LpnPI CCDG 8 cut(s) 70, 80, 134, 209, 294, 341, 573, 578
Lsp1109I GCAGC 3 cut(s) 350, 410, 533
MaeI CTAG 1 cut(s) 387
MaeII ACGT 2 cut(s) 247, 533
MalI GATC 2 cut(s) 186, 305
MboI GATC 2 cut(s) 184, 303
MboII GAAGA 3 cut(s) 83, 242, 445
MlsI TGGCCA 2 cut(s) 141, 272
MluCI AATT 4 cut(s) 55, 349, 543, 675
MluNI TGGCCA 2 cut(s) 141, 272
MlyI GAGTC 1 cut(s) 662
MmeI TCCRAC 1 cut(s) 578
MnlI CCTC 5 cut(s) 112, 192, 219, 222, 652
Mox20I TGGCCA 2 cut(s) 141, 272
MscI TGGCCA 2 cut(s) 141, 272
MseI TTAA 1 cut(s) 26
Msp20I TGGCCA 2 cut(s) 141, 272
Mva1269I GAATGC 1 cut(s) 183
NcoI CCATGG 1 cut(s) 136
NdeII GATC 2 cut(s) 184, 303
NlaIII CATG 3 cut(s) 71, 140, 334
NlaIV GGNNCC 2 cut(s) 290, 316
NspV TTCGAA 1 cut(s) 265
PctI GAATGC 1 cut(s) 183
PfeI GAWTC 2 cut(s) 617, 662
PflMI CCANNNNNTGG 1 cut(s) 148
PkrI GCNGC 3 cut(s) 340, 400, 523
PleI GAGTC 1 cut(s) 661
PpsI GAGTC 1 cut(s) 661
PspN4I GGNNCC 2 cut(s) 290, 316
PstNI CAGNNNCTG 1 cut(s) 473
RsaI GTAC 1 cut(s) 290
RsaNI GTAC 1 cut(s) 289
SaqAI TTAA 1 cut(s) 26
SatI GCNGC 3 cut(s) 339, 399, 522
Sau3AI GATC 2 cut(s) 184, 303
SchI GAGTC 1 cut(s) 662
SetI ASST 9 cut(s) 124, 211, 250, 285, 536, 552, 570, 633, 699
SfuI TTCGAA 1 cut(s) 265
Sse9I AATT 4 cut(s) 55, 349, 543, 675
SsiI CCGC 2 cut(s) 321, 463
SspMI CTAG 1 cut(s) 387
StyI CCWWGG 2 cut(s) 136, 687
TaaI ACNGT 1 cut(s) 77
TaiI ACGT 2 cut(s) 250, 536
TaqI TCGA 2 cut(s) 53, 265
TasI AATT 4 cut(s) 55, 349, 543, 675
TfiI GAWTC 2 cut(s) 617, 662
Tru1I TTAA 1 cut(s) 26
Tru9I TTAA 1 cut(s) 26
TscAI CASTG 3 cut(s) 39, 99, 153
TseI GCWGC 3 cut(s) 338, 398, 521
TspDTI ATGAA 1 cut(s) 84
TspRI CASTG 3 cut(s) 39, 99, 153
Van91I CCANNNNNTGG 1 cut(s) 148
XapI RAATTY 1 cut(s) 55
XspI CTAG 1 cut(s) 387
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.