Rmu_sc0005083.1_g000015

DNA replication complex GINS protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005083.1
Physical Location & Seq
Reverse (-)
67523 .. 70424
2902 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005083.1_g000015.1.cds

Sequence Viewer

Length: 792 bp
atgggaaattactatgacattgacgatattcttgccgaggaagagcttgtctcagttgttttccagaaaggagcaaatggggttggaattgatcctagtgctgaagcctatagtgtcgaaccaggttcaaaggtcaagctgccgttctggcttgcttatgaattacacgcaagacaagtagtaacgatgaagcttcctgcgtgtttcaatcaacaaacaaggctggaactgggggctgatggaaaagctgtggatttgagatctcgatgtctatacttctatgaatttggatgcaagatagcaccactggttggtgatagagacatgggatcattcctgttatctgcattcaggaacaggtatcaggaagtcctggccaaggcacattctgcagcatatacagcagcttcaaaacttttgacgctcttaacaaaagaagaaatcaacttgtatgaggcagctcaatcctccatggcagcctttaagaagtggcggatgggtggcccgagattgcagagagcttccgacgtcgtcgtcggatgggcagcttggttctatgagtccacggtatcgggacaggttttggggcaggaaccagagttggggaaagcctatggagagaggtcggcaggcggcggtgtgtctccgatctgctcagaggtggaggacgagtgcaagggtggtgcggcggaggggatctggtgtctggtggggacgatctcgggctcacagataggcggtcgttgcttgtttcccggcatcggtgtcgtggaaagcttatggtggcagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

263

Amino Acids

28.63

Weight (kDa)

5.15

Isoelectric Point (pI)

39.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 533
AatII GACGTC 1 cut(s) 531
AccB7I CCANNNNNTGG 1 cut(s) 311
AciI CCGC 6 cut(s) 493, 633, 636, 686, 689, 738
AclWI GGATC 3 cut(s) 86, 337, 704
AcoI YGGCCR 1 cut(s) 375
AcsI RAATTY 1 cut(s) 284
AcuI CTGAAG 1 cut(s) 123
AcyI GRCGYC 1 cut(s) 528
AfiI CCNNNNNNNGG 4 cut(s) 311, 379, 602, 761
AgsI TTSAA 3 cut(s) 129, 208, 411
AjnI CCWGG 2 cut(s) 121, 372
AluBI AGCT 9 cut(s) 46, 139, 193, 248, 407, 461, 521, 548, 777
AluI AGCT 9 cut(s) 46, 139, 193, 248, 407, 461, 521, 548, 777
Alw26I GTCTC 3 cut(s) 55, 315, 648
AlwI GGATC 3 cut(s) 86, 337, 704
Ama87I CYCGRG 2 cut(s) 505, 721
AoxI GGCC 2 cut(s) 375, 502
ApeKI GCWGC 6 cut(s) 139, 392, 404, 458, 476, 545
ApoI RAATTY 1 cut(s) 284
AspS9I GGNCC 1 cut(s) 503
AsuC2I CCSGG 1 cut(s) 756
AsuHPI GGTGA 1 cut(s) 326
AvaI CYCGRG 2 cut(s) 505, 721
BalI TGGCCA 1 cut(s) 377
BanII GRGCYC 1 cut(s) 728
BbvI GCAGC 6 cut(s) 126, 404, 416, 470, 488, 557
BccI CCATC 3 cut(s) 233, 490, 534
BceAI ACGGC 1 cut(s) 127
BcgI CGANNNNNNTGC 4 cut(s) 14, 48, 748, 782
BciT130I CCWGG 2 cut(s) 123, 374
BcnI CCSGG 1 cut(s) 756
BcoDI GTCTC 3 cut(s) 55, 315, 648
BfaI CTAG 1 cut(s) 96
BfmI CTRYAG 2 cut(s) 109, 390
BglI GCCNNNNNGGC 1 cut(s) 148
BglII AGATCT 1 cut(s) 260
BisI GCNGC 8 cut(s) 140, 393, 405, 459, 477, 546, 634, 687
BlsI GCNGC 8 cut(s) 141, 394, 406, 460, 478, 547, 635, 688
Bme1390I CCNGG 3 cut(s) 123, 374, 756
BmeT110I CYCGRG 2 cut(s) 505, 721
BmgT120I GGNCC 1 cut(s) 503
BmiI GGNNCC 1 cut(s) 594
BmrFI CCNGG 3 cut(s) 123, 374, 756
BmrI ACTGGG 1 cut(s) 239
BmsI GCATC 2 cut(s) 281, 768
BmuI ACTGGG 1 cut(s) 239
BplI GAGNNNNNCTC 2 cut(s) 35, 67
BpuMI CCSGG 1 cut(s) 756
BsaHI GRCGYC 1 cut(s) 528
BsaJI CCNNGG 4 cut(s) 36, 378, 471, 564
BsaXI ACNNNNNCTCC 2 cut(s) 656, 686
Bsc4I CCNNNNNNNGG 4 cut(s) 311, 379, 602, 761
Bse1I ACTGG 2 cut(s) 234, 312
BseBI CCWGG 2 cut(s) 123, 374
BseDI CCNNGG 4 cut(s) 36, 378, 471, 564
BseGI GGATG 3 cut(s) 296, 501, 545
BseLI CCNNNNNNNGG 4 cut(s) 311, 379, 602, 761
BseMII CTCAG 2 cut(s) 66, 669
BseNI ACTGG 2 cut(s) 234, 312
BseXI GCAGC 6 cut(s) 126, 404, 416, 470, 488, 557
Bsh1285I CGRYCG 1 cut(s) 742
BshFI GGCC 2 cut(s) 377, 504
BsiEI CGRYCG 1 cut(s) 742
BsiHKCI CYCGRG 2 cut(s) 505, 721
BsiSI CCGG 1 cut(s) 756
BslFI GGGAC 2 cut(s) 588, 727
BslI CCNNNNNNNGG 4 cut(s) 311, 379, 602, 761
BsmAI GTCTC 3 cut(s) 55, 315, 648
BsmFI GGGAC 2 cut(s) 588, 727
BsmI GAATGC 1 cut(s) 347
BsnI GGCC 2 cut(s) 377, 504
BsoBI CYCGRG 2 cut(s) 505, 721
Bsp1286I GDGCHC 1 cut(s) 728
Bsp143I GATC 6 cut(s) 91, 260, 329, 648, 696, 717
Bsp19I CCATGG 1 cut(s) 471
BspACI CCGC 6 cut(s) 493, 633, 636, 686, 689, 738
BspANI GGCC 2 cut(s) 377, 504
BspCNI CTCAG 2 cut(s) 65, 668
BspLI GGNNCC 1 cut(s) 594
BspMAI CTGCAG 1 cut(s) 394
BspPI GGATC 3 cut(s) 86, 337, 704
BspQI GCTCTTC 1 cut(s) 36
BsrI ACTGG 2 cut(s) 234, 312
BssECI CCNNGG 4 cut(s) 36, 378, 471, 564
BssMI GATC 6 cut(s) 91, 260, 329, 648, 696, 717
BssNI GRCGYC 1 cut(s) 528
BssT1I CCWWGG 2 cut(s) 378, 471
Bst2UI CCWGG 2 cut(s) 123, 374
Bst4CI ACNGT 1 cut(s) 568
Bst6I CTCTTC 1 cut(s) 36
BstACI GRCGYC 1 cut(s) 528
BstAPI GCANNNNNTGC 1 cut(s) 389
BstC8I GCNNGC 2 cut(s) 153, 631
BstDEI CTNAG 2 cut(s) 52, 655
BstDSI CCRYGG 2 cut(s) 471, 564
BstENI CCTNNNNNAGG 1 cut(s) 377
BstF5I GGATG 3 cut(s) 296, 501, 545
BstKTI GATC 6 cut(s) 94, 263, 332, 651, 699, 720
BstMAI GTCTC 3 cut(s) 55, 315, 648
BstMBI GATC 6 cut(s) 91, 260, 329, 648, 696, 717
BstMCI CGRYCG 1 cut(s) 742
BstMWI GCNNNNNNNGC 4 cut(s) 148, 389, 401, 744
BstNI CCWGG 2 cut(s) 123, 374
BstSCI CCNGG 3 cut(s) 121, 372, 754
BstSFI CTRYAG 2 cut(s) 109, 390
BstV1I GCAGC 6 cut(s) 126, 404, 416, 470, 488, 557
BstX2I RGATCY 2 cut(s) 260, 696
BstYI RGATCY 2 cut(s) 260, 696
BsuRI GGCC 2 cut(s) 377, 504
BtgI CCRYGG 2 cut(s) 471, 564
BtsCI GGATG 3 cut(s) 296, 501, 545
BtsIMutI CAGTG 1 cut(s) 305
Cac8I GCNNGC 2 cut(s) 153, 631
Cfr13I GGNCC 1 cut(s) 503
CseI GACGC 1 cut(s) 430
CsiI ACCWGGT 1 cut(s) 121
CviAII CATG 2 cut(s) 325, 472
DdeI CTNAG 2 cut(s) 52, 655
DpnI GATC 6 cut(s) 93, 262, 331, 650, 698, 719
DpnII GATC 6 cut(s) 91, 260, 329, 648, 696, 717
DrdI GACNNNNNNGTC 1 cut(s) 533
DseDI GACNNNNNNGTC 1 cut(s) 533
EaeI YGGCCR 1 cut(s) 375
Eam1104I CTCTTC 1 cut(s) 36
EarI CTCTTC 1 cut(s) 36
EciI GGCGGA 2 cut(s) 508, 704
Eco130I CCWWGG 2 cut(s) 378, 471
Eco24I GRGCYC 1 cut(s) 728
Eco57I CTGAAG 1 cut(s) 123
Eco88I CYCGRG 2 cut(s) 505, 721
EcoNI CCTNNNNNAGG 1 cut(s) 377
EcoRII CCWGG 2 cut(s) 121, 372
EcoT14I CCWWGG 2 cut(s) 378, 471
EcoT38I GRGCYC 1 cut(s) 728
ErhI CCWWGG 2 cut(s) 378, 471
FaeI CATG 2 cut(s) 328, 475
FaqI GGGAC 2 cut(s) 588, 727
FatI CATG 2 cut(s) 324, 471
Fnu4HI GCNGC 8 cut(s) 140, 393, 405, 459, 477, 546, 634, 687
FokI GGATG 3 cut(s) 303, 508, 552
FriOI GRGCYC 1 cut(s) 728
Fsp4HI GCNGC 8 cut(s) 140, 393, 405, 459, 477, 546, 634, 687
FspBI CTAG 1 cut(s) 96
GluI GCNGC 8 cut(s) 140, 393, 405, 459, 477, 546, 634, 687
HaeIII GGCC 2 cut(s) 377, 504
HapII CCGG 1 cut(s) 756
HgaI GACGC 1 cut(s) 430
Hin1I GRCGYC 1 cut(s) 528
Hin1II CATG 2 cut(s) 328, 475
HindIII AAGCTT 2 cut(s) 191, 775
HinfI GANTC 1 cut(s) 560
HpaII CCGG 1 cut(s) 756
HphI GGTGA 1 cut(s) 326
Hpy166II GTNNAC 1 cut(s) 564
Hpy188I TCNGA 4 cut(s) 526, 539, 648, 658
Hpy188III TCNNGA 5 cut(s) 64, 264, 352, 365, 573
Hpy8I GTNNAC 1 cut(s) 564
Hpy99I CGWCG 4 cut(s) 530, 533, 536, 539
HpyCH4III ACNGT 1 cut(s) 568
HpyCH4IV ACGT 1 cut(s) 528
HpyCH4V TGCA 5 cut(s) 294, 347, 392, 514, 675
HpyF10VI GCNNNNNNNGC 4 cut(s) 148, 389, 401, 744
HpyF3I CTNAG 2 cut(s) 52, 655
HpySE526I ACGT 1 cut(s) 528
Hsp92I GRCGYC 1 cut(s) 528
Hsp92II CATG 2 cut(s) 328, 475
Kzo9I GATC 6 cut(s) 91, 260, 329, 648, 696, 717
LguI GCTCTTC 1 cut(s) 36
LmnI GCTCC 1 cut(s) 71
Lsp1109I GCAGC 6 cut(s) 126, 404, 416, 470, 488, 557
LweI GCATC 2 cut(s) 281, 768
MabI ACCWGGT 1 cut(s) 121
MaeI CTAG 1 cut(s) 96
MaeII ACGT 1 cut(s) 528
MaeIII GTNAC 1 cut(s) 181
MalI GATC 6 cut(s) 93, 262, 331, 650, 698, 719
MboI GATC 6 cut(s) 91, 260, 329, 648, 696, 717
MboII GAAGA 2 cut(s) 53, 449
MflI RGATCY 2 cut(s) 260, 696
MhlI GDGCHC 1 cut(s) 728
MlsI TGGCCA 1 cut(s) 377
MluCI AATT 4 cut(s) 7, 87, 161, 284
MluNI TGGCCA 1 cut(s) 377
MlyI GAGTC 1 cut(s) 569
MmeI TCCRAC 3 cut(s) 64, 517, 549
MnlI CCTC 7 cut(s) 31, 448, 478, 615, 652, 658, 685
Mox20I TGGCCA 1 cut(s) 377
MscI TGGCCA 1 cut(s) 377
MseI TTAA 2 cut(s) 428, 483
Msp20I TGGCCA 1 cut(s) 377
MspI CCGG 1 cut(s) 756
MspR9I CCNGG 3 cut(s) 123, 374, 756
Mva1269I GAATGC 1 cut(s) 347
MvaI CCWGG 2 cut(s) 123, 374
MwoI GCNNNNNNNGC 4 cut(s) 148, 389, 401, 744
NciI CCSGG 1 cut(s) 756
NcoI CCATGG 1 cut(s) 471
NdeII GATC 6 cut(s) 91, 260, 329, 648, 696, 717
NlaIII CATG 2 cut(s) 328, 475
NlaIV GGNNCC 1 cut(s) 594
NmeAIII GCCGAG 1 cut(s) 61
PciSI GCTCTTC 1 cut(s) 36
PctI GAATGC 1 cut(s) 347
PflFI GACNNNGTC 1 cut(s) 530
PflMI CCANNNNNTGG 1 cut(s) 311
PkrI GCNGC 8 cut(s) 141, 394, 406, 460, 478, 547, 635, 688
PleI GAGTC 1 cut(s) 568
PpsI GAGTC 1 cut(s) 568
Psp6I CCWGG 2 cut(s) 121, 372
PspGI CCWGG 2 cut(s) 121, 372
PspN4I GGNNCC 1 cut(s) 594
PspPI GGNCC 1 cut(s) 503
PstI CTGCAG 1 cut(s) 394
PsuI RGATCY 2 cut(s) 260, 696
PsyI GACNNNGTC 1 cut(s) 530
SapI GCTCTTC 1 cut(s) 36
SaqAI TTAA 2 cut(s) 428, 483
SatI GCNGC 8 cut(s) 140, 393, 405, 459, 477, 546, 634, 687
Sau3AI GATC 6 cut(s) 91, 260, 329, 648, 696, 717
Sau96I GGNCC 1 cut(s) 503
SchI GAGTC 1 cut(s) 569
ScrFI CCNGG 3 cut(s) 123, 374, 756
SduI GDGCHC 1 cut(s) 728
SexAI ACCWGGT 1 cut(s) 121
SfaNI GCATC 2 cut(s) 281, 768
SfcI CTRYAG 2 cut(s) 109, 390
Sse9I AATT 4 cut(s) 7, 87, 161, 284
SsiI CCGC 6 cut(s) 493, 633, 636, 686, 689, 738
SspMI CTAG 1 cut(s) 96
StyD4I CCNGG 3 cut(s) 121, 372, 754
StyI CCWWGG 2 cut(s) 378, 471
TaaI ACNGT 1 cut(s) 568
TaiI ACGT 1 cut(s) 531
TaqI TCGA 2 cut(s) 117, 265
TasI AATT 4 cut(s) 7, 87, 161, 284
TauI GCSGC 2 cut(s) 636, 689
Tru1I TTAA 2 cut(s) 428, 483
Tru9I TTAA 2 cut(s) 428, 483
TscAI CASTG 1 cut(s) 312
TseI GCWGC 6 cut(s) 139, 392, 404, 458, 476, 545
TspDTI ATGAA 3 cut(s) 174, 203, 297
TspRI CASTG 1 cut(s) 312
Tth111I GACNNNGTC 1 cut(s) 530
Van91I CCANNNNNTGG 1 cut(s) 311
XagI CCTNNNNNAGG 1 cut(s) 377
XapI RAATTY 1 cut(s) 284
XspI CTAG 1 cut(s) 96
ZraI GACGTC 1 cut(s) 529
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.