Rmu_sc0011509.1_g000003

DNA replication complex GINS protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011509.1
Physical Location & Seq
Forward (+)
5846 .. 7681
1836 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011509.1_g000003.1.cds

Sequence Viewer

Length: 558 bp
atgggaaattactatgacattgacgatattcttgccgaggaagagcttgtctcagttgttttccagaaaggagcaaatggggttggaattgatcctagtgctgaagcctatagtgtcgaaccaggttcaaaggtcaagctgccgttctggcttgcttatgaattacacgcaagacaagtagtcacaatgaagcttcctgcgtgtttcaatcaacaaacaaggctggaactgggggctgatggaaaagctgtggatttgagatctcgatgtctatacttctatgaatttggatgcaagatagcaccactggttggtgatagagacatgggatcattcctgttatctgcattcaggaacaggtatcaggaagtcctggccaaggcacattctgcagcatatacagcagcttcaaaacttttgacgctcttaacaaaagaagaaatcaacttgtatgaggcagctcaatcctccatggcagcctttaagaagtggcggatgggtggcccgagattgcagagagcttccgtacttgggaggaagaggaaatcaactgactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

185

Amino Acids

20.63

Weight (kDa)

8.91

Isoelectric Point (pI)

35.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 311
AciI CCGC 1 cut(s) 493
AclWI GGATC 2 cut(s) 86, 337
AcoI YGGCCR 1 cut(s) 375
AcsI RAATTY 1 cut(s) 284
AcuI CTGAAG 1 cut(s) 123
AfaI GTAC 1 cut(s) 528
AfiI CCNNNNNNNGG 3 cut(s) 311, 379, 531
AgsI TTSAA 3 cut(s) 129, 208, 411
AhdI GACNNNNNGTC 1 cut(s) 179
AjnI CCWGG 2 cut(s) 121, 372
AluBI AGCT 7 cut(s) 46, 139, 193, 248, 407, 461, 521
AluI AGCT 7 cut(s) 46, 139, 193, 248, 407, 461, 521
Alw26I GTCTC 2 cut(s) 55, 315
AlwI GGATC 2 cut(s) 86, 337
Ama87I CYCGRG 1 cut(s) 505
AoxI GGCC 2 cut(s) 375, 502
ApeKI GCWGC 5 cut(s) 139, 392, 404, 458, 476
ApoI RAATTY 1 cut(s) 284
AspS9I GGNCC 1 cut(s) 503
AsuHPI GGTGA 1 cut(s) 326
AvaI CYCGRG 1 cut(s) 505
BalI TGGCCA 1 cut(s) 377
BbvI GCAGC 5 cut(s) 126, 404, 416, 470, 488
BccI CCATC 2 cut(s) 233, 490
BceAI ACGGC 1 cut(s) 127
BcgI CGANNNNNNTGC 2 cut(s) 14, 48
BciT130I CCWGG 2 cut(s) 123, 374
BcoDI GTCTC 2 cut(s) 55, 315
BfaI CTAG 2 cut(s) 96, 556
BfmI CTRYAG 2 cut(s) 109, 390
BglI GCCNNNNNGGC 1 cut(s) 148
BglII AGATCT 1 cut(s) 260
BisI GCNGC 5 cut(s) 140, 393, 405, 459, 477
BlsI GCNGC 5 cut(s) 141, 394, 406, 460, 478
Bme1390I CCNGG 2 cut(s) 123, 374
BmeRI GACNNNNNGTC 1 cut(s) 179
BmeT110I CYCGRG 1 cut(s) 505
BmgT120I GGNCC 1 cut(s) 503
BmrFI CCNGG 2 cut(s) 123, 374
BmrI ACTGGG 1 cut(s) 239
BmsI GCATC 1 cut(s) 281
BmuI ACTGGG 1 cut(s) 239
BplI GAGNNNNNCTC 2 cut(s) 35, 67
BsaJI CCNNGG 3 cut(s) 36, 378, 471
Bsc4I CCNNNNNNNGG 3 cut(s) 311, 379, 531
Bse1I ACTGG 2 cut(s) 234, 312
BseBI CCWGG 2 cut(s) 123, 374
BseDI CCNNGG 3 cut(s) 36, 378, 471
BseGI GGATG 2 cut(s) 296, 501
BseLI CCNNNNNNNGG 3 cut(s) 311, 379, 531
BseMII CTCAG 1 cut(s) 66
BseNI ACTGG 2 cut(s) 234, 312
BseXI GCAGC 5 cut(s) 126, 404, 416, 470, 488
BshFI GGCC 2 cut(s) 377, 504
BsiHKCI CYCGRG 1 cut(s) 505
BslI CCNNNNNNNGG 3 cut(s) 311, 379, 531
BsmAI GTCTC 2 cut(s) 55, 315
BsmI GAATGC 1 cut(s) 347
BsnI GGCC 2 cut(s) 377, 504
BsoBI CYCGRG 1 cut(s) 505
Bsp143I GATC 3 cut(s) 91, 260, 329
Bsp19I CCATGG 1 cut(s) 471
BspACI CCGC 1 cut(s) 493
BspANI GGCC 2 cut(s) 377, 504
BspCNI CTCAG 1 cut(s) 65
BspMAI CTGCAG 1 cut(s) 394
BspPI GGATC 2 cut(s) 86, 337
BspQI GCTCTTC 1 cut(s) 36
BsrI ACTGG 2 cut(s) 234, 312
BssECI CCNNGG 3 cut(s) 36, 378, 471
BssMI GATC 3 cut(s) 91, 260, 329
BssT1I CCWWGG 2 cut(s) 378, 471
Bst2UI CCWGG 2 cut(s) 123, 374
Bst6I CTCTTC 2 cut(s) 36, 533
BstAPI GCANNNNNTGC 1 cut(s) 389
BstC8I GCNNGC 1 cut(s) 153
BstDEI CTNAG 1 cut(s) 52
BstDSI CCRYGG 1 cut(s) 471
BstENI CCTNNNNNAGG 1 cut(s) 377
BstF5I GGATG 2 cut(s) 296, 501
BstKTI GATC 3 cut(s) 94, 263, 332
BstMAI GTCTC 2 cut(s) 55, 315
BstMBI GATC 3 cut(s) 91, 260, 329
BstMWI GCNNNNNNNGC 3 cut(s) 148, 389, 401
BstNI CCWGG 2 cut(s) 123, 374
BstSCI CCNGG 2 cut(s) 121, 372
BstSFI CTRYAG 2 cut(s) 109, 390
BstV1I GCAGC 5 cut(s) 126, 404, 416, 470, 488
BstX2I RGATCY 1 cut(s) 260
BstYI RGATCY 1 cut(s) 260
BsuRI GGCC 2 cut(s) 377, 504
BtgI CCRYGG 1 cut(s) 471
BtsCI GGATG 2 cut(s) 296, 501
BtsIMutI CAGTG 1 cut(s) 305
Cac8I GCNNGC 1 cut(s) 153
Cfr13I GGNCC 1 cut(s) 503
CseI GACGC 1 cut(s) 430
CsiI ACCWGGT 1 cut(s) 121
Csp6I GTAC 1 cut(s) 527
CviAII CATG 2 cut(s) 325, 472
CviQI GTAC 1 cut(s) 527
DdeI CTNAG 1 cut(s) 52
DpnI GATC 3 cut(s) 93, 262, 331
DpnII GATC 3 cut(s) 91, 260, 329
DriI GACNNNNNGTC 1 cut(s) 179
EaeI YGGCCR 1 cut(s) 375
Eam1104I CTCTTC 2 cut(s) 36, 533
Eam1105I GACNNNNNGTC 1 cut(s) 179
EarI CTCTTC 2 cut(s) 36, 533
EciI GGCGGA 1 cut(s) 508
Eco130I CCWWGG 2 cut(s) 378, 471
Eco57I CTGAAG 1 cut(s) 123
Eco88I CYCGRG 1 cut(s) 505
EcoNI CCTNNNNNAGG 1 cut(s) 377
EcoRII CCWGG 2 cut(s) 121, 372
EcoT14I CCWWGG 2 cut(s) 378, 471
ErhI CCWWGG 2 cut(s) 378, 471
FaeI CATG 2 cut(s) 328, 475
FatI CATG 2 cut(s) 324, 471
Fnu4HI GCNGC 5 cut(s) 140, 393, 405, 459, 477
FokI GGATG 2 cut(s) 303, 508
Fsp4HI GCNGC 5 cut(s) 140, 393, 405, 459, 477
FspBI CTAG 2 cut(s) 96, 556
GluI GCNGC 5 cut(s) 140, 393, 405, 459, 477
HaeIII GGCC 2 cut(s) 377, 504
HgaI GACGC 1 cut(s) 430
Hin1II CATG 2 cut(s) 328, 475
HindIII AAGCTT 1 cut(s) 191
HphI GGTGA 1 cut(s) 326
Hpy188III TCNNGA 4 cut(s) 64, 264, 352, 365
HpyCH4V TGCA 4 cut(s) 294, 347, 392, 514
HpyF10VI GCNNNNNNNGC 3 cut(s) 148, 389, 401
HpyF3I CTNAG 1 cut(s) 52
Hsp92II CATG 2 cut(s) 328, 475
Kzo9I GATC 3 cut(s) 91, 260, 329
LguI GCTCTTC 1 cut(s) 36
LmnI GCTCC 1 cut(s) 71
Lsp1109I GCAGC 5 cut(s) 126, 404, 416, 470, 488
LweI GCATC 1 cut(s) 281
MabI ACCWGGT 1 cut(s) 121
MaeI CTAG 2 cut(s) 96, 556
MaeIII GTNAC 1 cut(s) 181
MalI GATC 3 cut(s) 93, 262, 331
MboI GATC 3 cut(s) 91, 260, 329
MboII GAAGA 3 cut(s) 53, 449, 550
MflI RGATCY 1 cut(s) 260
MlsI TGGCCA 1 cut(s) 377
MluCI AATT 4 cut(s) 7, 87, 161, 284
MluNI TGGCCA 1 cut(s) 377
MmeI TCCRAC 1 cut(s) 64
MnlI CCTC 5 cut(s) 31, 448, 478, 528, 534
Mox20I TGGCCA 1 cut(s) 377
MscI TGGCCA 1 cut(s) 377
MseI TTAA 2 cut(s) 428, 483
Msp20I TGGCCA 1 cut(s) 377
MspR9I CCNGG 2 cut(s) 123, 374
Mva1269I GAATGC 1 cut(s) 347
MvaI CCWGG 2 cut(s) 123, 374
MwoI GCNNNNNNNGC 3 cut(s) 148, 389, 401
NcoI CCATGG 1 cut(s) 471
NdeII GATC 3 cut(s) 91, 260, 329
NlaIII CATG 2 cut(s) 328, 475
NmeAIII GCCGAG 1 cut(s) 61
NmuCI GTSAC 1 cut(s) 181
PciSI GCTCTTC 1 cut(s) 36
PctI GAATGC 1 cut(s) 347
PflMI CCANNNNNTGG 1 cut(s) 311
PkrI GCNGC 5 cut(s) 141, 394, 406, 460, 478
Psp6I CCWGG 2 cut(s) 121, 372
PspGI CCWGG 2 cut(s) 121, 372
PspPI GGNCC 1 cut(s) 503
PstI CTGCAG 1 cut(s) 394
PsuI RGATCY 1 cut(s) 260
RsaI GTAC 1 cut(s) 528
RsaNI GTAC 1 cut(s) 527
SapI GCTCTTC 1 cut(s) 36
SaqAI TTAA 2 cut(s) 428, 483
SatI GCNGC 5 cut(s) 140, 393, 405, 459, 477
Sau3AI GATC 3 cut(s) 91, 260, 329
Sau96I GGNCC 1 cut(s) 503
ScrFI CCNGG 2 cut(s) 123, 374
SexAI ACCWGGT 1 cut(s) 121
SfaNI GCATC 1 cut(s) 281
SfcI CTRYAG 2 cut(s) 109, 390
Sse9I AATT 4 cut(s) 7, 87, 161, 284
SsiI CCGC 1 cut(s) 493
SspMI CTAG 2 cut(s) 96, 556
StyD4I CCNGG 2 cut(s) 121, 372
StyI CCWWGG 2 cut(s) 378, 471
TaqI TCGA 2 cut(s) 117, 265
TasI AATT 4 cut(s) 7, 87, 161, 284
Tru1I TTAA 2 cut(s) 428, 483
Tru9I TTAA 2 cut(s) 428, 483
TscAI CASTG 1 cut(s) 312
TseFI GTSAC 1 cut(s) 181
TseI GCWGC 5 cut(s) 139, 392, 404, 458, 476
Tsp45I GTSAC 1 cut(s) 181
TspDTI ATGAA 3 cut(s) 174, 203, 297
TspGWI ACGGA 1 cut(s) 514
TspRI CASTG 1 cut(s) 312
Van91I CCANNNNNTGG 1 cut(s) 311
XagI CCTNNNNNAGG 1 cut(s) 377
XapI RAATTY 1 cut(s) 284
XspI CTAG 2 cut(s) 96, 556
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.