Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005375.1

Orthogroup ID

OG0007273

Physical Location & Seq

Genomic Coordinates Forward (+)

131228 .. 133922

Gene Structure 2695 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005375.1_g000030.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1599 bp

atgtatcaacaaggtgaagcttatctctgtccgccaccctccatccattttggcggctcaaccagtatccaacaacctaatattcacacaatggtaacagcatcagggagcagtactaattttgacacccaacatttacccgagcgttatgatagtgccccattctacggaatgacccaatacaatgctcagcatcatcataatgttgatttgggtgttgcaactccagccaacttttattattcctacatgacaccttcatctagctctggggtattacctgttcctatgaatcatggggcctctgatttgctgccttcttctagcaattatggagtcgtcggaatttctgcagatgagtatggaaggaatagtcgcatcatggatgatctcagaggtccatgcaagagaaagaatcctgaatgcctgccggggaatttccaatatttcaatgcctctgcaagccctagtacttctgtgcctcctttgaatatgaggcatcctgaaggggtagctgtaatggatgctgtaaactttgccctacctcctcagttcgtaggaactggcaatccaccaattatggaagctggacctcagattagcatgaggaatcgttcagctacaactgggttggaatctgtaccaacacatgaccacaaccatctgagtcaaggaaactatgtgggtcagcgctttcagccggctggaacactctggttggaccaacatttaagtagtaatagtggagatggaggagcttcagcctggaatcaagttcctattccttttatgcatggtggcaatgtcggcggaggttccatggacagtgtcaacatgggtatgcaaagatatcatgattcatctagcaacagaagttcctctattctccggcatcctcctccgctcaaccaccggcatcaaaatcatcacgtagctccaccacccatgcaaggattgagaggccacaacctgaatcttccccacgtagccacagaaccttcatatagactaccctcaagttcctcacgcagctccaccaggaatccatctcagaatggtctggagattggtcgtaggcaaccaggacccattccacaaaccggctttaggatatacaggcctcaccaaggagtcatttctgagacagctctaagacaccacaaccttgcgcattggagagttcttggggttgatgagggtgtcatactagatgttccagaatttggcaactttggtgaccagcacagagatatgcggttggacatagaggacatgtcctatgaggagcttcttgcattgggggaacaaattggccatgtaaacactgggttgtcggaggacagcattagcaaacaactaaagacaaggagttatttatcatctggtacagttataaatctggaagaagctggatgtccagagaaggaagttgatttttgcataatatgccaggattattataagaaccaggagaagatagggactcttcattgtggacacgagtatcatgcagattgcttaaagaagtggttgcttgtgaaaaatgtctgccccatctgcaaatccgaagcactgatcacagggaagaaggatgtatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

zf-RING_2

Protein Analysis

532

Amino Acids

58.41

Weight (kDa)

6.36

Isoelectric Point (pI)

53.67

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007273)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G53190 AT1G53190 AT3G15070 AT3G15070
fragaria_vesca	FvH4_3g19090 FvH4_3g19090 FvH4_3g19090
malus_domestica	MD03G1237000.v1.1 MD11G1257600.v1.1
prunus_persica	Prupe.4G172400_v2.0.a1 Prupe.4G172400_v2.0.a1
pyrus_communis	pycom03g18280 pycom03g18290 pycom11g22740
rosa_chinensis	RchiOBHm_Chr5g0031881
rosa_laevigata	RLG00000033355
rosa_multiflora	Rmu_sc0005375.1_g000030
rosa_roxburghii	Rroxscaffold_1G00048380
rosa_rugosa	Rorug05G0128400 Rorug05G0128500
rosa_samantha	Rh5AG222700 Rh5BG222900 Rh5CG246000 Rh5DG227700
rosa_wichuraiana	Rw5G020290

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	2 cut(s)	1394, 1461
Acc16I	TGCGCA	1 cut(s)	1170
AccB7I	CCANNNNNTGG	1 cut(s)	1223
AccBSI	CCGCTC	1 cut(s)	904
AciI	CCGC	5 cut(s)	32, 54, 810, 902, 1255
AcoI	YGGCCR	1 cut(s)	1312
AcsI	RAATTY	3 cut(s)	345, 436, 1220
AcuI	CTGAAG	2 cut(s)	525, 744
AfaI	GTAC	4 cut(s)	115, 472, 642, 1387
AfeI	AGCGCT	1 cut(s)	692
AfiI	CCNNNNNNNGG	6 cut(s)	167, 950, 1100, 1107, 1127, 1223
AflIII	ACRYGT	1 cut(s)	1272
AgsI	TTSAA	2 cut(s)	451, 490
AjnI	CCWGG	5 cut(s)	764, 1037, 1081, 1449, 1467
AloI	GAACNNNNNNTCC	2 cut(s)	553, 585
Alw26I	GTCTC	1 cut(s)	1136
Ama87I	CYCGRG	1 cut(s)	140
Aor51HI	AGCGCT	1 cut(s)	692
AoxI	GGCC	4 cut(s)	300, 961, 1118, 1312
ApeKI	GCWGC	2 cut(s)	313, 1029
ApoI	RAATTY	3 cut(s)	345, 436, 1220
AspLEI	GCGC	2 cut(s)	693, 1171
AspS9I	GGNCC	5 cut(s)	300, 398, 590, 721, 1085
AsuC2I	CCSGG	1 cut(s)	432
AsuHPI	GGTGA	3 cut(s)	26, 1115, 1247
AvaI	CYCGRG	1 cut(s)	140
AvaII	GGWCC	4 cut(s)	398, 590, 721, 1085
BaeGI	GKGCMC	1 cut(s)	160
BaeI	ACNNNNGTAYC	2 cut(s)	1487, 1520
BalI	TGGCCA	1 cut(s)	1314
BauI	CACGAG	1 cut(s)	1499
BbvI	GCAGC	2 cut(s)	300, 1041
BccI	CCATC	5 cut(s)	50, 669, 743, 1054, 1562
BcgI	CGANNNNNNTGC	2 cut(s)	1490, 1524
BciT130I	CCWGG	5 cut(s)	766, 1039, 1083, 1451, 1469
BciVI	GTATCC	1 cut(s)	77
BclI	TGATCA	1 cut(s)	1575
BcnI	CCSGG	1 cut(s)	432
BcoDI	GTCTC	1 cut(s)	1136
BfaI	CTAG	5 cut(s)	264, 324, 468, 864, 1208
BfmI	CTRYAG	1 cut(s)	351
BfoI	RGCGCY	1 cut(s)	694
BfuI	GTATCC	1 cut(s)	77
BisI	GCNGC	3 cut(s)	55, 314, 1030
BlpI	GCTNAGC	1 cut(s)	189
BlsI	GCNGC	3 cut(s)	56, 315, 1031
BmcAI	AGTACT	2 cut(s)	115, 472
Bme1390I	CCNGG	6 cut(s)	432, 766, 1039, 1083, 1451, 1469
Bme18I	GGWCC	4 cut(s)	398, 590, 721, 1085
BmeT110I	CYCGRG	1 cut(s)	140
BmgT120I	GGNCC	5 cut(s)	300, 398, 590, 721, 1085
BmiI	GGNNCC	3 cut(s)	301, 817, 1087
BmrFI	CCNGG	6 cut(s)	432, 766, 1039, 1083, 1451, 1469
BmrI	ACTGGG	2 cut(s)	636, 1335
BmsI	GCATC	7 cut(s)	110, 202, 387, 508, 514, 901, 925
BmuI	ACTGGG	2 cut(s)	636, 1335
BpmI	CTGGAG	2 cut(s)	210, 1082
Bpu1102I	GCTNAGC	1 cut(s)	189
BpuEI	CTTGAG	1 cut(s)	1000
BpuMI	CCSGG	1 cut(s)	432
BsaAI	YACGTR	2 cut(s)	931, 985
BsaJI	CCNNGG	3 cut(s)	431, 819, 1126
Bsc4I	CCNNNNNNNGG	6 cut(s)	167, 950, 1100, 1107, 1127, 1223
Bse118I	RCCGGY	3 cut(s)	700, 912, 1100
Bse1I	ACTGG	4 cut(s)	63, 568, 631, 1330
Bse3DI	GCAATG	1 cut(s)	808
BseBI	CCWGG	5 cut(s)	766, 1039, 1083, 1451, 1469
BseDI	CCNNGG	3 cut(s)	431, 819, 1126
BseGI	GGATG	7 cut(s)	42, 391, 499, 529, 892, 1418, 1597
BseLI	CCNNNNNNNGG	6 cut(s)	167, 950, 1100, 1107, 1127, 1223
BseMI	GCAATG	1 cut(s)	808
BseMII	CTCAG	7 cut(s)	203, 406, 563, 608, 656, 1064, 1131
BseNI	ACTGG	4 cut(s)	63, 568, 631, 1330
BseRI	GAGGAG	4 cut(s)	537, 768, 888, 1298
BseSI	GKGCMC	1 cut(s)	160
BseXI	GCAGC	2 cut(s)	300, 1041
BshFI	GGCC	4 cut(s)	302, 963, 1120, 1314
BsiHKCI	CYCGRG	1 cut(s)	140
BsiSI	CCGG	5 cut(s)	431, 701, 889, 913, 1101
BslFI	GGGAC	1 cut(s)	1495
BslI	CCNNNNNNNGG	6 cut(s)	167, 950, 1100, 1107, 1127, 1223
BsmAI	GTCTC	1 cut(s)	1136
BsmFI	GGGAC	1 cut(s)	1495
BsmI	GAATGC	1 cut(s)	428
BsnI	GGCC	4 cut(s)	302, 963, 1120, 1314
BsoBI	CYCGRG	1 cut(s)	140
Bsp1286I	GDGCHC	1 cut(s)	160
Bsp143I	GATC	2 cut(s)	388, 1575
Bsp1720I	GCTNAGC	1 cut(s)	189
Bsp19I	CCATGG	1 cut(s)	819
BspACI	CCGC	5 cut(s)	32, 54, 810, 902, 1255
BspANI	GGCC	4 cut(s)	302, 963, 1120, 1314
BspCNI	CTCAG	7 cut(s)	202, 405, 562, 607, 657, 1063, 1132
BspHI	TCATGA	1 cut(s)	853
BspLI	GGNNCC	3 cut(s)	301, 817, 1087
BspMAI	CTGCAG	1 cut(s)	355
BsrBI	CCGCTC	1 cut(s)	904
BsrDI	GCAATG	1 cut(s)	808
BsrFI	RCCGGY	3 cut(s)	700, 912, 1100
BsrI	ACTGG	4 cut(s)	63, 568, 631, 1330
BssAI	RCCGGY	3 cut(s)	700, 912, 1100
BssECI	CCNNGG	3 cut(s)	431, 819, 1126
BssMI	GATC	2 cut(s)	388, 1575
BssSI	CACGAG	1 cut(s)	1499
BssT1I	CCWWGG	2 cut(s)	819, 1126
Bst2BI	CACGAG	1 cut(s)	1499
Bst2UI	CCWGG	5 cut(s)	766, 1039, 1083, 1451, 1469
Bst4CI	ACNGT	2 cut(s)	827, 1390
Bst6I	CTCTTC	1 cut(s)	1491
BstAPI	GCANNNNNTGC	1 cut(s)	1446
BstBAI	YACGTR	2 cut(s)	931, 985
BstC8I	GCNNGC	3 cut(s)	428, 463, 702
BstDEI	CTNAG	8 cut(s)	189, 392, 549, 594, 665, 1050, 1140, 1151
BstDSI	CCRYGG	1 cut(s)	819
BstEII	GGTNACC	1 cut(s)	1235
BstENI	CCTNNNNNAGG	1 cut(s)	1125
BstF5I	GGATG	7 cut(s)	42, 391, 499, 529, 892, 1418, 1597
BstH2I	RGCGCY	1 cut(s)	694
BstHHI	GCGC	2 cut(s)	693, 1171
BstKTI	GATC	2 cut(s)	391, 1578
BstMAI	GTCTC	1 cut(s)	1136
BstMBI	GATC	2 cut(s)	388, 1575
BstMWI	GCNNNNNNNGC	5 cut(s)	227, 697, 807, 1446, 1557
BstNI	CCWGG	5 cut(s)	766, 1039, 1083, 1451, 1469
BstNSI	RCATGY	1 cut(s)	1276
BstPI	GGTNACC	1 cut(s)	1235
BstSCI	CCNGG	6 cut(s)	430, 764, 1037, 1081, 1449, 1467
BstSFI	CTRYAG	1 cut(s)	351
BstSLI	GKGCMC	1 cut(s)	160
BstV1I	GCAGC	2 cut(s)	300, 1041
BsuI	GTATCC	1 cut(s)	77
BsuRI	GGCC	4 cut(s)	302, 963, 1120, 1314
BtgI	CCRYGG	1 cut(s)	819
BtsCI	GGATG	7 cut(s)	42, 391, 499, 529, 892, 1418, 1597
BtsIMutI	CAGTG	3 cut(s)	832, 1323, 1571
Cac8I	GCNNGC	3 cut(s)	428, 463, 702
CciI	TCATGA	1 cut(s)	853
CfoI	GCGC	2 cut(s)	693, 1171
Cfr10I	RCCGGY	3 cut(s)	700, 912, 1100
Cfr13I	GGNCC	5 cut(s)	300, 398, 590, 721, 1085
Csp6I	GTAC	4 cut(s)	114, 471, 641, 1386
CviQI	GTAC	4 cut(s)	114, 471, 641, 1386
DdeI	CTNAG	8 cut(s)	189, 392, 549, 594, 665, 1050, 1140, 1151
DpnI	GATC	2 cut(s)	390, 1577
DpnII	GATC	2 cut(s)	388, 1575
EaeI	YGGCCR	1 cut(s)	1312
Eam1104I	CTCTTC	1 cut(s)	1491
EarI	CTCTTC	1 cut(s)	1491
EciI	GGCGGA	2 cut(s)	21, 825
Eco130I	CCWWGG	2 cut(s)	819, 1126
Eco147I	AGGCCT	1 cut(s)	1120
Eco32I	GATATC	1 cut(s)	851
Eco47I	GGWCC	4 cut(s)	398, 590, 721, 1085
Eco47III	AGCGCT	1 cut(s)	692
Eco57I	CTGAAG	2 cut(s)	525, 744
Eco88I	CYCGRG	1 cut(s)	140
Eco91I	GGTNACC	1 cut(s)	1235
EcoNI	CCTNNNNNAGG	1 cut(s)	1125
EcoO109I	RGGNCCY	2 cut(s)	300, 1085
EcoO65I	GGTNACC	1 cut(s)	1235
EcoRII	CCWGG	5 cut(s)	764, 1037, 1081, 1449, 1467
EcoRV	GATATC	1 cut(s)	851
EcoT14I	CCWWGG	2 cut(s)	819, 1126
EcoT22I	ATGCAT	1 cut(s)	795
ErhI	CCWWGG	2 cut(s)	819, 1126
FaqI	GGGAC	1 cut(s)	1495
FbaI	TGATCA	1 cut(s)	1575
Fnu4HI	GCNGC	3 cut(s)	55, 314, 1030
FokI	GGATG	6 cut(s)	29, 398, 486, 536, 879, 1425
Fsp4HI	GCNGC	3 cut(s)	55, 314, 1030
FspBI	CTAG	5 cut(s)	264, 324, 468, 864, 1208
FspI	TGCGCA	1 cut(s)	1170
GlaI	GCGC	2 cut(s)	692, 1170
GluI	GCNGC	3 cut(s)	55, 314, 1030
GsuI	CTGGAG	2 cut(s)	210, 1082
HaeII	RGCGCY	1 cut(s)	694
HaeIII	GGCC	4 cut(s)	302, 963, 1120, 1314
HapII	CCGG	5 cut(s)	431, 701, 889, 913, 1101
HhaI	GCGC	2 cut(s)	693, 1171
Hin6I	GCGC	2 cut(s)	691, 1169
HinP1I	GCGC	2 cut(s)	691, 1169
HincII	GTYRAC	1 cut(s)	832
HindII	GTYRAC	1 cut(s)	832
HindIII	AAGCTT	1 cut(s)	18
HpaII	CCGG	5 cut(s)	431, 701, 889, 913, 1101
HphI	GGTGA	3 cut(s)	26, 1115, 1247
Hpy166II	GTNNAC	4 cut(s)	532, 832, 1321, 1496
Hpy188I	TCNGA	9 cut(s)	307, 344, 395, 597, 666, 1053, 1141, 1336, 1567
Hpy188III	TCNNGA	7 cut(s)	419, 503, 854, 1061, 1217, 1400, 1418
Hpy8I	GTNNAC	4 cut(s)	532, 832, 1321, 1496
Hpy99I	CGWCG	1 cut(s)	344
HpyAV	CCTTC	7 cut(s)	267, 327, 360, 500, 1008, 1417, 1582
HpyCH4III	ACNGT	2 cut(s)	827, 1390
HpyCH4IV	ACGT	2 cut(s)	930, 984
HpyF10VI	GCNNNNNNNGC	5 cut(s)	227, 697, 807, 1446, 1557
HpyF3I	CTNAG	8 cut(s)	189, 392, 549, 594, 665, 1050, 1140, 1151
HpySE526I	ACGT	2 cut(s)	930, 984
HspAI	GCGC	2 cut(s)	691, 1169
KroI	GCCGGC	1 cut(s)	700
KroNI	GCCGGC	1 cut(s)	702
Ksp22I	TGATCA	1 cut(s)	1575
Kzo9I	GATC	2 cut(s)	388, 1575
LmnI	GCTCC	5 cut(s)	108, 755, 940, 1037, 1285
Lsp1109I	GCAGC	2 cut(s)	300, 1041
LweI	GCATC	7 cut(s)	110, 202, 387, 508, 514, 901, 925
MaeI	CTAG	5 cut(s)	264, 324, 468, 864, 1208
MaeII	ACGT	2 cut(s)	930, 984
MaeIII	GTNAC	2 cut(s)	94, 1235
MalI	GATC	2 cut(s)	390, 1577
MbiI	CCGCTC	1 cut(s)	904
MboI	GATC	2 cut(s)	388, 1575
MboII	GAAGA	6 cut(s)	312, 968, 1415, 1478, 1486, 1597
MhlI	GDGCHC	1 cut(s)	160
MlsI	TGGCCA	1 cut(s)	1314
MluCI	AATT	7 cut(s)	118, 328, 345, 436, 576, 1220, 1308
MluNI	TGGCCA	1 cut(s)	1314
MlyI	GAGTC	4 cut(s)	345, 676, 1140, 1477
MmeI	TCCRAC	6 cut(s)	94, 322, 612, 699, 1239, 1314
Mox20I	TGGCCA	1 cut(s)	1314
Mph1103I	ATGCAT	1 cut(s)	795
MroNI	GCCGGC	1 cut(s)	700
MscI	TGGCCA	1 cut(s)	1314
MseI	TTAA	2 cut(s)	731, 1520
MslI	CAYNNNNRTG	2 cut(s)	201, 839
Msp20I	TGGCCA	1 cut(s)	1314
MspI	CCGG	5 cut(s)	431, 701, 889, 913, 1101
MspR9I	CCNGG	6 cut(s)	432, 766, 1039, 1083, 1451, 1469
Mva1269I	GAATGC	1 cut(s)	428
MvaI	CCWGG	5 cut(s)	766, 1039, 1083, 1451, 1469
MwoI	GCNNNNNNNGC	5 cut(s)	227, 697, 807, 1446, 1557
NaeI	GCCGGC	1 cut(s)	702
NciI	CCSGG	1 cut(s)	432
NcoI	CCATGG	1 cut(s)	819
NdeII	GATC	2 cut(s)	388, 1575
NgoMIV	GCCGGC	1 cut(s)	700
NlaIV	GGNNCC	3 cut(s)	301, 817, 1087
NmuCI	GTSAC	1 cut(s)	1235
NsbI	TGCGCA	1 cut(s)	1170
NsiI	ATGCAT	1 cut(s)	795
NspI	RCATGY	1 cut(s)	1276
PagI	TCATGA	1 cut(s)	853
PceI	AGGCCT	1 cut(s)	1120
PciI	ACATGT	1 cut(s)	1272
PctI	GAATGC	1 cut(s)	428
PdiI	GCCGGC	1 cut(s)	702
PfeI	GAWTC	8 cut(s)	292, 415, 610, 635, 769, 857, 973, 1042
PflFI	GACNNNGTC	1 cut(s)	827
PflMI	CCANNNNNTGG	1 cut(s)	1223
PkrI	GCNGC	3 cut(s)	56, 315, 1031
PleI	GAGTC	4 cut(s)	344, 675, 1139, 1477
PpsI	GAGTC	4 cut(s)	344, 675, 1139, 1477
Ppu21I	YACGTR	2 cut(s)	931, 985
PpuMI	RGGWCCY	1 cut(s)	1085
PscI	ACATGT	1 cut(s)	1272
PsiI	TTATAA	2 cut(s)	1394, 1461
Psp5II	RGGWCCY	1 cut(s)	1085
Psp6I	CCWGG	5 cut(s)	764, 1037, 1081, 1449, 1467
PspEI	GGTNACC	1 cut(s)	1235
PspGI	CCWGG	5 cut(s)	764, 1037, 1081, 1449, 1467
PspN4I	GGNNCC	3 cut(s)	301, 817, 1087
PspPI	GGNCC	5 cut(s)	300, 398, 590, 721, 1085
PspPPI	RGGWCCY	1 cut(s)	1085
PsrI	GAACNNNNNNTAC	2 cut(s)	267, 299
PstI	CTGCAG	1 cut(s)	355
PsyI	GACNNNGTC	1 cut(s)	827
RsaI	GTAC	4 cut(s)	115, 472, 642, 1387
RsaNI	GTAC	4 cut(s)	114, 471, 641, 1386
RseI	CAYNNNNRTG	2 cut(s)	201, 839
SaqAI	TTAA	2 cut(s)	731, 1520
SatI	GCNGC	3 cut(s)	55, 314, 1030
Sau3AI	GATC	2 cut(s)	388, 1575
Sau96I	GGNCC	5 cut(s)	300, 398, 590, 721, 1085
ScaI	AGTACT	2 cut(s)	115, 472
SchI	GAGTC	4 cut(s)	345, 676, 1140, 1477
ScrFI	CCNGG	6 cut(s)	432, 766, 1039, 1083, 1451, 1469
SduI	GDGCHC	1 cut(s)	160
SfaNI	GCATC	7 cut(s)	110, 202, 387, 508, 514, 901, 925
SfcI	CTRYAG	1 cut(s)	351
SinI	GGWCC	4 cut(s)	398, 590, 721, 1085
SmiMI	CAYNNNNRTG	2 cut(s)	201, 839
SmlI	CTYRAG	1 cut(s)	1015
SmoI	CTYRAG	1 cut(s)	1015
Sse9I	AATT	7 cut(s)	118, 328, 345, 436, 576, 1220, 1308
SseBI	AGGCCT	1 cut(s)	1120
SsiI	CCGC	5 cut(s)	32, 54, 810, 902, 1255
SspI	AATATT	2 cut(s)	82, 446
SspMI	CTAG	5 cut(s)	264, 324, 468, 864, 1208
StuI	AGGCCT	1 cut(s)	1120
StyD4I	CCNGG	6 cut(s)	430, 764, 1037, 1081, 1449, 1467
StyI	CCWWGG	2 cut(s)	819, 1126
TaaI	ACNGT	2 cut(s)	827, 1390
TaiI	ACGT	2 cut(s)	933, 987
TasI	AATT	7 cut(s)	118, 328, 345, 436, 576, 1220, 1308
TatI	WGTACW	2 cut(s)	113, 470
TauI	GCSGC	1 cut(s)	57
TfiI	GAWTC	8 cut(s)	292, 415, 610, 635, 769, 857, 973, 1042
Tru1I	TTAA	2 cut(s)	731, 1520
Tru9I	TTAA	2 cut(s)	731, 1520
TscAI	CASTG	3 cut(s)	832, 1330, 1578
TseFI	GTSAC	1 cut(s)	1235
TseI	GCWGC	2 cut(s)	313, 1029
Tsp45I	GTSAC	1 cut(s)	1235
TspDTI	ATGAA	5 cut(s)	249, 305, 849, 990, 1478
TspGWI	ACGGA	1 cut(s)	183
TspRI	CASTG	3 cut(s)	832, 1330, 1578
Tth111I	GACNNNGTC	1 cut(s)	827
Van91I	CCANNNNNTGG	1 cut(s)	1223
VpaK11BI	GGWCC	4 cut(s)	398, 590, 721, 1085
XagI	CCTNNNNNAGG	1 cut(s)	1125
XapI	RAATTY	3 cut(s)	345, 436, 1220
XceI	RCATGY	1 cut(s)	1276
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1322
XspI	CTAG	5 cut(s)	264, 324, 468, 864, 1208
ZrmI	AGTACT	2 cut(s)	115, 472
Zsp2I	ATGCAT	1 cut(s)	795

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.