Rmu_sc0005375.1_g000030

Encoded by

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005375.1
OG0007273
Physical Location & Seq
Forward (+)
131228 .. 133922
2695 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1599 bp
atgtatcaacaaggtgaagcttatctctgtccgccaccctccatccattttggcggctcaaccagtatccaacaacctaatattcacacaatggtaacagcatcagggagcagtactaattttgacacccaacatttacccgagcgttatgatagtgccccattctacggaatgacccaatacaatgctcagcatcatcataatgttgatttgggtgttgcaactccagccaacttttattattcctacatgacaccttcatctagctctggggtattacctgttcctatgaatcatggggcctctgatttgctgccttcttctagcaattatggagtcgtcggaatttctgcagatgagtatggaaggaatagtcgcatcatggatgatctcagaggtccatgcaagagaaagaatcctgaatgcctgccggggaatttccaatatttcaatgcctctgcaagccctagtacttctgtgcctcctttgaatatgaggcatcctgaaggggtagctgtaatggatgctgtaaactttgccctacctcctcagttcgtaggaactggcaatccaccaattatggaagctggacctcagattagcatgaggaatcgttcagctacaactgggttggaatctgtaccaacacatgaccacaaccatctgagtcaaggaaactatgtgggtcagcgctttcagccggctggaacactctggttggaccaacatttaagtagtaatagtggagatggaggagcttcagcctggaatcaagttcctattccttttatgcatggtggcaatgtcggcggaggttccatggacagtgtcaacatgggtatgcaaagatatcatgattcatctagcaacagaagttcctctattctccggcatcctcctccgctcaaccaccggcatcaaaatcatcacgtagctccaccacccatgcaaggattgagaggccacaacctgaatcttccccacgtagccacagaaccttcatatagactaccctcaagttcctcacgcagctccaccaggaatccatctcagaatggtctggagattggtcgtaggcaaccaggacccattccacaaaccggctttaggatatacaggcctcaccaaggagtcatttctgagacagctctaagacaccacaaccttgcgcattggagagttcttggggttgatgagggtgtcatactagatgttccagaatttggcaactttggtgaccagcacagagatatgcggttggacatagaggacatgtcctatgaggagcttcttgcattgggggaacaaattggccatgtaaacactgggttgtcggaggacagcattagcaaacaactaaagacaaggagttatttatcatctggtacagttataaatctggaagaagctggatgtccagagaaggaagttgatttttgcataatatgccaggattattataagaaccaggagaagatagggactcttcattgtggacacgagtatcatgcagattgcttaaagaagtggttgcttgtgaaaaatgtctgccccatctgcaaatccgaagcactgatcacagggaagaaggatgtatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
zf-RING_2

Protein Analysis

532

Amino Acids

58.41

Weight (kDa)

6.36

Isoelectric Point (pI)

53.67

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-rbx1 PF12678 472 - 521 4.6e-08 RING-H2 zinc finger domain
zf-RING_2 PF13639 480 - 521 2.1e-11 Ring finger domain
zf-C3HC4_2 PF13923 480 - 520 1.9e-07 Zinc finger, C3HC4 type (RING finger)
zf-C3HC4 PF00097 480 - 520 2e-07 Zinc finger, C3HC4 type (RING finger)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 1394, 1461
Acc16I TGCGCA 1 cut(s) 1170
AccB7I CCANNNNNTGG 1 cut(s) 1223
AccBSI CCGCTC 1 cut(s) 904
AciI CCGC 5 cut(s) 32, 54, 810, 902, 1255
AcoI YGGCCR 1 cut(s) 1312
AcsI RAATTY 3 cut(s) 345, 436, 1220
AcuI CTGAAG 2 cut(s) 525, 744
AfaI GTAC 4 cut(s) 115, 472, 642, 1387
AfeI AGCGCT 1 cut(s) 692
AfiI CCNNNNNNNGG 6 cut(s) 167, 950, 1100, 1107, 1127, 1223
AflIII ACRYGT 1 cut(s) 1272
AgsI TTSAA 2 cut(s) 451, 490
AjnI CCWGG 5 cut(s) 764, 1037, 1081, 1449, 1467
AloI GAACNNNNNNTCC 2 cut(s) 553, 585
Alw26I GTCTC 1 cut(s) 1136
Ama87I CYCGRG 1 cut(s) 140
Aor51HI AGCGCT 1 cut(s) 692
AoxI GGCC 4 cut(s) 300, 961, 1118, 1312
ApeKI GCWGC 2 cut(s) 313, 1029
ApoI RAATTY 3 cut(s) 345, 436, 1220
AspLEI GCGC 2 cut(s) 693, 1171
AspS9I GGNCC 5 cut(s) 300, 398, 590, 721, 1085
AsuC2I CCSGG 1 cut(s) 432
AsuHPI GGTGA 3 cut(s) 26, 1115, 1247
AvaI CYCGRG 1 cut(s) 140
AvaII GGWCC 4 cut(s) 398, 590, 721, 1085
BaeGI GKGCMC 1 cut(s) 160
BaeI ACNNNNGTAYC 2 cut(s) 1487, 1520
BalI TGGCCA 1 cut(s) 1314
BauI CACGAG 1 cut(s) 1499
BbvI GCAGC 2 cut(s) 300, 1041
BccI CCATC 5 cut(s) 50, 669, 743, 1054, 1562
BcgI CGANNNNNNTGC 2 cut(s) 1490, 1524
BciT130I CCWGG 5 cut(s) 766, 1039, 1083, 1451, 1469
BciVI GTATCC 1 cut(s) 77
BclI TGATCA 1 cut(s) 1575
BcnI CCSGG 1 cut(s) 432
BcoDI GTCTC 1 cut(s) 1136
BfaI CTAG 5 cut(s) 264, 324, 468, 864, 1208
BfmI CTRYAG 1 cut(s) 351
BfoI RGCGCY 1 cut(s) 694
BfuI GTATCC 1 cut(s) 77
BisI GCNGC 3 cut(s) 55, 314, 1030
BlpI GCTNAGC 1 cut(s) 189
BlsI GCNGC 3 cut(s) 56, 315, 1031
BmcAI AGTACT 2 cut(s) 115, 472
Bme1390I CCNGG 6 cut(s) 432, 766, 1039, 1083, 1451, 1469
Bme18I GGWCC 4 cut(s) 398, 590, 721, 1085
BmeT110I CYCGRG 1 cut(s) 140
BmgT120I GGNCC 5 cut(s) 300, 398, 590, 721, 1085
BmiI GGNNCC 3 cut(s) 301, 817, 1087
BmrFI CCNGG 6 cut(s) 432, 766, 1039, 1083, 1451, 1469
BmrI ACTGGG 2 cut(s) 636, 1335
BmsI GCATC 7 cut(s) 110, 202, 387, 508, 514, 901, 925
BmuI ACTGGG 2 cut(s) 636, 1335
BpmI CTGGAG 2 cut(s) 210, 1082
Bpu1102I GCTNAGC 1 cut(s) 189
BpuEI CTTGAG 1 cut(s) 1000
BpuMI CCSGG 1 cut(s) 432
BsaAI YACGTR 2 cut(s) 931, 985
BsaJI CCNNGG 3 cut(s) 431, 819, 1126
Bsc4I CCNNNNNNNGG 6 cut(s) 167, 950, 1100, 1107, 1127, 1223
Bse118I RCCGGY 3 cut(s) 700, 912, 1100
Bse1I ACTGG 4 cut(s) 63, 568, 631, 1330
Bse3DI GCAATG 1 cut(s) 808
BseBI CCWGG 5 cut(s) 766, 1039, 1083, 1451, 1469
BseDI CCNNGG 3 cut(s) 431, 819, 1126
BseGI GGATG 7 cut(s) 42, 391, 499, 529, 892, 1418, 1597
BseLI CCNNNNNNNGG 6 cut(s) 167, 950, 1100, 1107, 1127, 1223
BseMI GCAATG 1 cut(s) 808
BseMII CTCAG 7 cut(s) 203, 406, 563, 608, 656, 1064, 1131
BseNI ACTGG 4 cut(s) 63, 568, 631, 1330
BseRI GAGGAG 4 cut(s) 537, 768, 888, 1298
BseSI GKGCMC 1 cut(s) 160
BseXI GCAGC 2 cut(s) 300, 1041
BshFI GGCC 4 cut(s) 302, 963, 1120, 1314
BsiHKCI CYCGRG 1 cut(s) 140
BsiSI CCGG 5 cut(s) 431, 701, 889, 913, 1101
BslFI GGGAC 1 cut(s) 1495
BslI CCNNNNNNNGG 6 cut(s) 167, 950, 1100, 1107, 1127, 1223
BsmAI GTCTC 1 cut(s) 1136
BsmFI GGGAC 1 cut(s) 1495
BsmI GAATGC 1 cut(s) 428
BsnI GGCC 4 cut(s) 302, 963, 1120, 1314
BsoBI CYCGRG 1 cut(s) 140
Bsp1286I GDGCHC 1 cut(s) 160
Bsp143I GATC 2 cut(s) 388, 1575
Bsp1720I GCTNAGC 1 cut(s) 189
Bsp19I CCATGG 1 cut(s) 819
BspACI CCGC 5 cut(s) 32, 54, 810, 902, 1255
BspANI GGCC 4 cut(s) 302, 963, 1120, 1314
BspCNI CTCAG 7 cut(s) 202, 405, 562, 607, 657, 1063, 1132
BspHI TCATGA 1 cut(s) 853
BspLI GGNNCC 3 cut(s) 301, 817, 1087
BspMAI CTGCAG 1 cut(s) 355
BsrBI CCGCTC 1 cut(s) 904
BsrDI GCAATG 1 cut(s) 808
BsrFI RCCGGY 3 cut(s) 700, 912, 1100
BsrI ACTGG 4 cut(s) 63, 568, 631, 1330
BssAI RCCGGY 3 cut(s) 700, 912, 1100
BssECI CCNNGG 3 cut(s) 431, 819, 1126
BssMI GATC 2 cut(s) 388, 1575
BssSI CACGAG 1 cut(s) 1499
BssT1I CCWWGG 2 cut(s) 819, 1126
Bst2BI CACGAG 1 cut(s) 1499
Bst2UI CCWGG 5 cut(s) 766, 1039, 1083, 1451, 1469
Bst4CI ACNGT 2 cut(s) 827, 1390
Bst6I CTCTTC 1 cut(s) 1491
BstAPI GCANNNNNTGC 1 cut(s) 1446
BstBAI YACGTR 2 cut(s) 931, 985
BstC8I GCNNGC 3 cut(s) 428, 463, 702
BstDEI CTNAG 8 cut(s) 189, 392, 549, 594, 665, 1050, 1140, 1151
BstDSI CCRYGG 1 cut(s) 819
BstEII GGTNACC 1 cut(s) 1235
BstENI CCTNNNNNAGG 1 cut(s) 1125
BstF5I GGATG 7 cut(s) 42, 391, 499, 529, 892, 1418, 1597
BstH2I RGCGCY 1 cut(s) 694
BstHHI GCGC 2 cut(s) 693, 1171
BstKTI GATC 2 cut(s) 391, 1578
BstMAI GTCTC 1 cut(s) 1136
BstMBI GATC 2 cut(s) 388, 1575
BstMWI GCNNNNNNNGC 5 cut(s) 227, 697, 807, 1446, 1557
BstNI CCWGG 5 cut(s) 766, 1039, 1083, 1451, 1469
BstNSI RCATGY 1 cut(s) 1276
BstPI GGTNACC 1 cut(s) 1235
BstSCI CCNGG 6 cut(s) 430, 764, 1037, 1081, 1449, 1467
BstSFI CTRYAG 1 cut(s) 351
BstSLI GKGCMC 1 cut(s) 160
BstV1I GCAGC 2 cut(s) 300, 1041
BsuI GTATCC 1 cut(s) 77
BsuRI GGCC 4 cut(s) 302, 963, 1120, 1314
BtgI CCRYGG 1 cut(s) 819
BtsCI GGATG 7 cut(s) 42, 391, 499, 529, 892, 1418, 1597
BtsIMutI CAGTG 3 cut(s) 832, 1323, 1571
Cac8I GCNNGC 3 cut(s) 428, 463, 702
CciI TCATGA 1 cut(s) 853
CfoI GCGC 2 cut(s) 693, 1171
Cfr10I RCCGGY 3 cut(s) 700, 912, 1100
Cfr13I GGNCC 5 cut(s) 300, 398, 590, 721, 1085
Csp6I GTAC 4 cut(s) 114, 471, 641, 1386
CviQI GTAC 4 cut(s) 114, 471, 641, 1386
DdeI CTNAG 8 cut(s) 189, 392, 549, 594, 665, 1050, 1140, 1151
DpnI GATC 2 cut(s) 390, 1577
DpnII GATC 2 cut(s) 388, 1575
EaeI YGGCCR 1 cut(s) 1312
Eam1104I CTCTTC 1 cut(s) 1491
EarI CTCTTC 1 cut(s) 1491
EciI GGCGGA 2 cut(s) 21, 825
Eco130I CCWWGG 2 cut(s) 819, 1126
Eco147I AGGCCT 1 cut(s) 1120
Eco32I GATATC 1 cut(s) 851
Eco47I GGWCC 4 cut(s) 398, 590, 721, 1085
Eco47III AGCGCT 1 cut(s) 692
Eco57I CTGAAG 2 cut(s) 525, 744
Eco88I CYCGRG 1 cut(s) 140
Eco91I GGTNACC 1 cut(s) 1235
EcoNI CCTNNNNNAGG 1 cut(s) 1125
EcoO109I RGGNCCY 2 cut(s) 300, 1085
EcoO65I GGTNACC 1 cut(s) 1235
EcoRII CCWGG 5 cut(s) 764, 1037, 1081, 1449, 1467
EcoRV GATATC 1 cut(s) 851
EcoT14I CCWWGG 2 cut(s) 819, 1126
EcoT22I ATGCAT 1 cut(s) 795
ErhI CCWWGG 2 cut(s) 819, 1126
FaqI GGGAC 1 cut(s) 1495
FbaI TGATCA 1 cut(s) 1575
Fnu4HI GCNGC 3 cut(s) 55, 314, 1030
FokI GGATG 6 cut(s) 29, 398, 486, 536, 879, 1425
Fsp4HI GCNGC 3 cut(s) 55, 314, 1030
FspBI CTAG 5 cut(s) 264, 324, 468, 864, 1208
FspI TGCGCA 1 cut(s) 1170
GlaI GCGC 2 cut(s) 692, 1170
GluI GCNGC 3 cut(s) 55, 314, 1030
GsuI CTGGAG 2 cut(s) 210, 1082
HaeII RGCGCY 1 cut(s) 694
HaeIII GGCC 4 cut(s) 302, 963, 1120, 1314
HapII CCGG 5 cut(s) 431, 701, 889, 913, 1101
HhaI GCGC 2 cut(s) 693, 1171
Hin6I GCGC 2 cut(s) 691, 1169
HinP1I GCGC 2 cut(s) 691, 1169
HincII GTYRAC 1 cut(s) 832
HindII GTYRAC 1 cut(s) 832
HindIII AAGCTT 1 cut(s) 18
HpaII CCGG 5 cut(s) 431, 701, 889, 913, 1101
HphI GGTGA 3 cut(s) 26, 1115, 1247
Hpy166II GTNNAC 4 cut(s) 532, 832, 1321, 1496
Hpy188I TCNGA 9 cut(s) 307, 344, 395, 597, 666, 1053, 1141, 1336, 1567
Hpy188III TCNNGA 7 cut(s) 419, 503, 854, 1061, 1217, 1400, 1418
Hpy8I GTNNAC 4 cut(s) 532, 832, 1321, 1496
Hpy99I CGWCG 1 cut(s) 344
HpyAV CCTTC 7 cut(s) 267, 327, 360, 500, 1008, 1417, 1582
HpyCH4III ACNGT 2 cut(s) 827, 1390
HpyCH4IV ACGT 2 cut(s) 930, 984
HpyF10VI GCNNNNNNNGC 5 cut(s) 227, 697, 807, 1446, 1557
HpyF3I CTNAG 8 cut(s) 189, 392, 549, 594, 665, 1050, 1140, 1151
HpySE526I ACGT 2 cut(s) 930, 984
HspAI GCGC 2 cut(s) 691, 1169
KroI GCCGGC 1 cut(s) 700
KroNI GCCGGC 1 cut(s) 702
Ksp22I TGATCA 1 cut(s) 1575
Kzo9I GATC 2 cut(s) 388, 1575
LmnI GCTCC 5 cut(s) 108, 755, 940, 1037, 1285
Lsp1109I GCAGC 2 cut(s) 300, 1041
LweI GCATC 7 cut(s) 110, 202, 387, 508, 514, 901, 925
MaeI CTAG 5 cut(s) 264, 324, 468, 864, 1208
MaeII ACGT 2 cut(s) 930, 984
MaeIII GTNAC 2 cut(s) 94, 1235
MalI GATC 2 cut(s) 390, 1577
MbiI CCGCTC 1 cut(s) 904
MboI GATC 2 cut(s) 388, 1575
MboII GAAGA 6 cut(s) 312, 968, 1415, 1478, 1486, 1597
MhlI GDGCHC 1 cut(s) 160
MlsI TGGCCA 1 cut(s) 1314
MluCI AATT 7 cut(s) 118, 328, 345, 436, 576, 1220, 1308
MluNI TGGCCA 1 cut(s) 1314
MlyI GAGTC 4 cut(s) 345, 676, 1140, 1477
MmeI TCCRAC 6 cut(s) 94, 322, 612, 699, 1239, 1314
Mox20I TGGCCA 1 cut(s) 1314
Mph1103I ATGCAT 1 cut(s) 795
MroNI GCCGGC 1 cut(s) 700
MscI TGGCCA 1 cut(s) 1314
MseI TTAA 2 cut(s) 731, 1520
MslI CAYNNNNRTG 2 cut(s) 201, 839
Msp20I TGGCCA 1 cut(s) 1314
MspI CCGG 5 cut(s) 431, 701, 889, 913, 1101
MspR9I CCNGG 6 cut(s) 432, 766, 1039, 1083, 1451, 1469
Mva1269I GAATGC 1 cut(s) 428
MvaI CCWGG 5 cut(s) 766, 1039, 1083, 1451, 1469
MwoI GCNNNNNNNGC 5 cut(s) 227, 697, 807, 1446, 1557
NaeI GCCGGC 1 cut(s) 702
NciI CCSGG 1 cut(s) 432
NcoI CCATGG 1 cut(s) 819
NdeII GATC 2 cut(s) 388, 1575
NgoMIV GCCGGC 1 cut(s) 700
NlaIV GGNNCC 3 cut(s) 301, 817, 1087
NmuCI GTSAC 1 cut(s) 1235
NsbI TGCGCA 1 cut(s) 1170
NsiI ATGCAT 1 cut(s) 795
NspI RCATGY 1 cut(s) 1276
PagI TCATGA 1 cut(s) 853
PceI AGGCCT 1 cut(s) 1120
PciI ACATGT 1 cut(s) 1272
PctI GAATGC 1 cut(s) 428
PdiI GCCGGC 1 cut(s) 702
PfeI GAWTC 8 cut(s) 292, 415, 610, 635, 769, 857, 973, 1042
PflFI GACNNNGTC 1 cut(s) 827
PflMI CCANNNNNTGG 1 cut(s) 1223
PkrI GCNGC 3 cut(s) 56, 315, 1031
PleI GAGTC 4 cut(s) 344, 675, 1139, 1477
PpsI GAGTC 4 cut(s) 344, 675, 1139, 1477
Ppu21I YACGTR 2 cut(s) 931, 985
PpuMI RGGWCCY 1 cut(s) 1085
PscI ACATGT 1 cut(s) 1272
PsiI TTATAA 2 cut(s) 1394, 1461
Psp5II RGGWCCY 1 cut(s) 1085
Psp6I CCWGG 5 cut(s) 764, 1037, 1081, 1449, 1467
PspEI GGTNACC 1 cut(s) 1235
PspGI CCWGG 5 cut(s) 764, 1037, 1081, 1449, 1467
PspN4I GGNNCC 3 cut(s) 301, 817, 1087
PspPI GGNCC 5 cut(s) 300, 398, 590, 721, 1085
PspPPI RGGWCCY 1 cut(s) 1085
PsrI GAACNNNNNNTAC 2 cut(s) 267, 299
PstI CTGCAG 1 cut(s) 355
PsyI GACNNNGTC 1 cut(s) 827
RsaI GTAC 4 cut(s) 115, 472, 642, 1387
RsaNI GTAC 4 cut(s) 114, 471, 641, 1386
RseI CAYNNNNRTG 2 cut(s) 201, 839
SaqAI TTAA 2 cut(s) 731, 1520
SatI GCNGC 3 cut(s) 55, 314, 1030
Sau3AI GATC 2 cut(s) 388, 1575
Sau96I GGNCC 5 cut(s) 300, 398, 590, 721, 1085
ScaI AGTACT 2 cut(s) 115, 472
SchI GAGTC 4 cut(s) 345, 676, 1140, 1477
ScrFI CCNGG 6 cut(s) 432, 766, 1039, 1083, 1451, 1469
SduI GDGCHC 1 cut(s) 160
SfaNI GCATC 7 cut(s) 110, 202, 387, 508, 514, 901, 925
SfcI CTRYAG 1 cut(s) 351
SinI GGWCC 4 cut(s) 398, 590, 721, 1085
SmiMI CAYNNNNRTG 2 cut(s) 201, 839
SmlI CTYRAG 1 cut(s) 1015
SmoI CTYRAG 1 cut(s) 1015
Sse9I AATT 7 cut(s) 118, 328, 345, 436, 576, 1220, 1308
SseBI AGGCCT 1 cut(s) 1120
SsiI CCGC 5 cut(s) 32, 54, 810, 902, 1255
SspI AATATT 2 cut(s) 82, 446
SspMI CTAG 5 cut(s) 264, 324, 468, 864, 1208
StuI AGGCCT 1 cut(s) 1120
StyD4I CCNGG 6 cut(s) 430, 764, 1037, 1081, 1449, 1467
StyI CCWWGG 2 cut(s) 819, 1126
TaaI ACNGT 2 cut(s) 827, 1390
TaiI ACGT 2 cut(s) 933, 987
TasI AATT 7 cut(s) 118, 328, 345, 436, 576, 1220, 1308
TatI WGTACW 2 cut(s) 113, 470
TauI GCSGC 1 cut(s) 57
TfiI GAWTC 8 cut(s) 292, 415, 610, 635, 769, 857, 973, 1042
Tru1I TTAA 2 cut(s) 731, 1520
Tru9I TTAA 2 cut(s) 731, 1520
TscAI CASTG 3 cut(s) 832, 1330, 1578
TseFI GTSAC 1 cut(s) 1235
TseI GCWGC 2 cut(s) 313, 1029
Tsp45I GTSAC 1 cut(s) 1235
TspDTI ATGAA 5 cut(s) 249, 305, 849, 990, 1478
TspGWI ACGGA 1 cut(s) 183
TspRI CASTG 3 cut(s) 832, 1330, 1578
Tth111I GACNNNGTC 1 cut(s) 827
Van91I CCANNNNNTGG 1 cut(s) 1223
VpaK11BI GGWCC 4 cut(s) 398, 590, 721, 1085
XagI CCTNNNNNAGG 1 cut(s) 1125
XapI RAATTY 3 cut(s) 345, 436, 1220
XceI RCATGY 1 cut(s) 1276
XcmI CCANNNNNNNNNTGG 1 cut(s) 1322
XspI CTAG 5 cut(s) 264, 324, 468, 864, 1208
ZrmI AGTACT 2 cut(s) 115, 472
Zsp2I ATGCAT 1 cut(s) 795
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.