Rmu_sc0006031.1_g000025
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006031.1
Physical Location & Seq
Reverse (-)
130955 .. 131303
349 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006031.1_g000025.1.cds

Sequence Viewer

Length: 219 bp
atggcctctgtaagtgtggctcctttatctggattaagataccacagtggaattacagttgctatcaatagttggcccagtgagatgaatgacatgaaaattggggatgacaaggaaatggaagcaactgttgtagatggtaatggaacagaaacgggtcatataattgtcacaactattggtggaagaaatggtcggccaaagaaggtgactttttaa
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

7.65

Weight (kDa)

6.03

Isoelectric Point (pI)

21.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017873)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 197
AfiI CCNNNNNNNGG 1 cut(s) 29
AoxI GGCC 3 cut(s) 3, 74, 197
AspS9I GGNCC 1 cut(s) 75
BaeI ACNNNNGTAYC 2 cut(s) 31, 64
BccI CCATC 1 cut(s) 131
BmgT120I GGNCC 1 cut(s) 75
BmiI GGNNCC 1 cut(s) 21
BmrI ACTGGG 1 cut(s) 72
BmuI ACTGGG 1 cut(s) 72
Bsc4I CCNNNNNNNGG 1 cut(s) 29
Bse1I ACTGG 1 cut(s) 78
BseGI GGATG 1 cut(s) 112
BseLI CCNNNNNNNGG 1 cut(s) 29
BseNI ACTGG 1 cut(s) 78
BshFI GGCC 3 cut(s) 5, 76, 199
BslI CCNNNNNNNGG 1 cut(s) 29
BsnI GGCC 3 cut(s) 5, 76, 199
BspANI GGCC 3 cut(s) 5, 76, 199
BspLI GGNNCC 1 cut(s) 21
BsrI ACTGG 1 cut(s) 78
Bst4CI ACNGT 3 cut(s) 47, 58, 130
BstF5I GGATG 1 cut(s) 112
BsuRI GGCC 3 cut(s) 5, 76, 199
BtsCI GGATG 1 cut(s) 112
BtsIMutI CAGTG 2 cut(s) 52, 85
Cfr13I GGNCC 1 cut(s) 75
CviAII CATG 1 cut(s) 94
CviJI RGCY 4 cut(s) 5, 20, 76, 199
CviKI_1 RGCY 4 cut(s) 5, 20, 76, 199
EaeI YGGCCR 1 cut(s) 197
FaeI CATG 1 cut(s) 97
FaiI YATR 3 cut(s) 95, 162, 164
FatI CATG 1 cut(s) 93
FokI GGATG 1 cut(s) 119
HaeIII GGCC 3 cut(s) 5, 76, 199
Hin1II CATG 1 cut(s) 97
Hpy188III TCNNGA 1 cut(s) 30
HpyAV CCTTC 1 cut(s) 199
HpyCH4III ACNGT 3 cut(s) 47, 58, 130
Hsp92II CATG 1 cut(s) 97
LmnI GCTCC 1 cut(s) 25
LpnPI CCDG 2 cut(s) 15, 91
MaeIII GTNAC 2 cut(s) 169, 208
MboII GAAGA 1 cut(s) 198
MluCI AATT 3 cut(s) 51, 99, 165
MnlI CCTC 1 cut(s) 16
MseI TTAA 2 cut(s) 35, 217
NlaIII CATG 1 cut(s) 97
NlaIV GGNNCC 1 cut(s) 21
NmuCI GTSAC 2 cut(s) 169, 208
PspN4I GGNNCC 1 cut(s) 21
PspPI GGNCC 1 cut(s) 75
SaqAI TTAA 2 cut(s) 35, 217
Sau96I GGNCC 1 cut(s) 75
SetI ASST 1 cut(s) 210
SgeI CNNG 5 cut(s) 42, 90, 106, 124, 168
Sse9I AATT 3 cut(s) 51, 99, 165
TaaI ACNGT 3 cut(s) 47, 58, 130
TasI AATT 3 cut(s) 51, 99, 165
Tru1I TTAA 2 cut(s) 35, 217
Tru9I TTAA 2 cut(s) 35, 217
TscAI CASTG 2 cut(s) 52, 85
TseFI GTSAC 2 cut(s) 169, 208
Tsp45I GTSAC 2 cut(s) 169, 208
TspDTI ATGAA 2 cut(s) 101, 110
TspRI CASTG 2 cut(s) 52, 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.