Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006802.1

Orthogroup ID

OG0012132

Physical Location & Seq

Genomic Coordinates Reverse (-)

26488 .. 27889

Gene Structure 1402 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006802.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 657 bp

atgagtgttagggaggcttggaaatcaacttcaagaaggtggggaggtgggaatagcaacccttgtggtggcaacagcggtggtgcaactccacactctgagggaagcttcaagaagcaaatggaagggtttagcaacatgtatggtagcggtggttatggttatggtgagaatgcaacagtgaggaagagagtcatggtggtggtggatgactcatctcattccaaacatgcaatgatgtgggctctcactcatgttgccaacaagggtgatttgcttactcttcttcacatcatgccttctagttcacatggggactcttctgctggttctccataccttgcaaactctcttgggtctctttgcaaggcttgcaagcctgaggttgaagtggaagcacttgtgatccaaggacctagactagccacagtgatcagccaagtgaagaagctagaggtctcagtcctagttctgggtcagaagaaagcttctcccctcattagctgcttatatggaacaagcagaactgaggagtttgtggaacattgcatcaacaatgcagattgcttgactattggagtgaggaagcaaagcaaaggtgtgggtggctatctcatcaacactagatggcagaaggatttctggctcttggcctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Usp

Protein Analysis

218

Amino Acids

23.47

Weight (kDa)

9.14

Isoelectric Point (pI)

45.44

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012132)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G44760 AT1G44760
fragaria_vesca	FvH4_2g26790
malus_domestica	MD08G1165100.v1.1 MD15G1350900.v1.1
prunus_persica	Prupe.1G499800_v2.0.a1
pyrus_communis	pycom15g31340
rosa_chinensis	RchiOBHm_Chr6g0295651
rosa_laevigata	RLG00000011779
rosa_multiflora	Rmu_sc0006802.1_g000009 Rmu_sc0015254.1_g000001
rosa_roxburghii	Rroxscaffold_7G00172270
rosa_rugosa	Rorug06G0253200 Rorug06G0253200
rosa_samantha	Rh6AG366200 Rh6BG374400 Rh6CG380600 Rh6DG367500
rosa_wichuraiana	Rw6G031960

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	78, 150
AclWI	GGATC	1 cut(s)	400
AfiI	CCNNNNNNNGG	2 cut(s)	68, 472
AflIII	ACRYGT	1 cut(s)	138
AgsI	TTSAA	3 cut(s)	33, 112, 389
AluBI	AGCT	4 cut(s)	108, 451, 488, 504
AluI	AGCT	4 cut(s)	108, 451, 488, 504
Alw26I	GTCTC	2 cut(s)	363, 463
AlwI	GGATC	1 cut(s)	400
AoxI	GGCC	1 cut(s)	651
ApeKI	GCWGC	1 cut(s)	504
Asp700I	GAANNNNTTC	1 cut(s)	638
AspS9I	GGNCC	1 cut(s)	413
AsuHPI	GGTGA	2 cut(s)	179, 281
AvaII	GGWCC	1 cut(s)	413
AxyI	CCTNAGG	1 cut(s)	381
BanII	GRGCYC	1 cut(s)	247
BbvI	GCAGC	1 cut(s)	491
BccI	CCATC	1 cut(s)	621
BclI	TGATCA	1 cut(s)	432
BcoDI	GTCTC	2 cut(s)	363, 463
BfaI	CTAG	7 cut(s)	303, 417, 422, 452, 467, 624, 655
BisI	GCNGC	1 cut(s)	505
BlsI	GCNGC	1 cut(s)	506
Bme18I	GGWCC	1 cut(s)	413
BmgT120I	GGNCC	1 cut(s)	413
BmsI	GCATC	1 cut(s)	558
BsaI	GGTCTC	2 cut(s)	363, 463
BsaJI	CCNNGG	1 cut(s)	409
Bsc4I	CCNNNNNNNGG	2 cut(s)	68, 472
Bse21I	CCTNAGG	1 cut(s)	381
Bse3DI	GCAATG	2 cut(s)	240, 544
BseDI	CCNNGG	1 cut(s)	409
BseGI	GGATG	1 cut(s)	214
BseLI	CCNNNNNNNGG	2 cut(s)	68, 472
BseMI	GCAATG	2 cut(s)	240, 544
BseMII	CTCAG	4 cut(s)	90, 372, 474, 519
BseRI	GAGGAG	1 cut(s)	545
BseXI	GCAGC	1 cut(s)	491
BshFI	GGCC	1 cut(s)	653
BslFI	GGGAC	1 cut(s)	329
BslI	CCNNNNNNNGG	2 cut(s)	68, 472
BsmAI	GTCTC	2 cut(s)	363, 463
BsmFI	GGGAC	1 cut(s)	329
BsmI	GAATGC	1 cut(s)	178
BsnI	GGCC	1 cut(s)	653
Bso31I	GGTCTC	2 cut(s)	363, 463
Bsp1286I	GDGCHC	1 cut(s)	247
Bsp143I	GATC	2 cut(s)	405, 432
BspACI	CCGC	2 cut(s)	78, 150
BspANI	GGCC	1 cut(s)	653
BspCNI	CTCAG	4 cut(s)	91, 373, 473, 520
BspPI	GGATC	1 cut(s)	400
BspTNI	GGTCTC	2 cut(s)	363, 463
BsrDI	GCAATG	2 cut(s)	240, 544
BssECI	CCNNGG	1 cut(s)	409
BssMI	GATC	2 cut(s)	405, 432
BssT1I	CCWWGG	1 cut(s)	409
Bst4CI	ACNGT	2 cut(s)	181, 430
Bst6I	CTCTTC	3 cut(s)	182, 288, 325
BstAPI	GCANNNNNTGC	1 cut(s)	372
BstC8I	GCNNGC	2 cut(s)	373, 377
BstDEI	CTNAG	4 cut(s)	99, 381, 460, 528
BstF5I	GGATG	1 cut(s)	214
BstKTI	GATC	2 cut(s)	408, 435
BstMAI	GTCTC	2 cut(s)	363, 463
BstMBI	GATC	2 cut(s)	405, 432
BstMWI	GCNNNNNNNGC	1 cut(s)	372
BstNSI	RCATGY	2 cut(s)	142, 233
BstV1I	GCAGC	1 cut(s)	491
Bsu36I	CCTNAGG	1 cut(s)	381
BsuRI	GGCC	1 cut(s)	653
BtsCI	GGATG	1 cut(s)	214
BtsIMutI	CAGTG	2 cut(s)	186, 435
Cac8I	GCNNGC	2 cut(s)	373, 377
Cfr13I	GGNCC	1 cut(s)	413
CspCI	CAANNNNNGTGG	4 cut(s)	46, 61, 81, 96
CviAII	CATG	6 cut(s)	139, 196, 230, 254, 295, 311
DdeI	CTNAG	4 cut(s)	99, 381, 460, 528
DpnI	GATC	2 cut(s)	407, 434
DpnII	GATC	2 cut(s)	405, 432
Eam1104I	CTCTTC	3 cut(s)	182, 288, 325
EarI	CTCTTC	3 cut(s)	182, 288, 325
Eco130I	CCWWGG	1 cut(s)	409
Eco24I	GRGCYC	1 cut(s)	247
Eco31I	GGTCTC	2 cut(s)	363, 463
Eco47I	GGWCC	1 cut(s)	413
Eco81I	CCTNAGG	1 cut(s)	381
EcoO109I	RGGNCCY	1 cut(s)	413
EcoT14I	CCWWGG	1 cut(s)	409
EcoT38I	GRGCYC	1 cut(s)	247
ErhI	CCWWGG	1 cut(s)	409
FaeI	CATG	6 cut(s)	142, 199, 233, 257, 298, 314
FaqI	GGGAC	1 cut(s)	329
FatI	CATG	6 cut(s)	138, 195, 229, 253, 294, 310
FbaI	TGATCA	1 cut(s)	432
Fnu4HI	GCNGC	1 cut(s)	505
FokI	GGATG	1 cut(s)	221
FriOI	GRGCYC	1 cut(s)	247
Fsp4HI	GCNGC	1 cut(s)	505
FspBI	CTAG	7 cut(s)	303, 417, 422, 452, 467, 624, 655
GluI	GCNGC	1 cut(s)	505
HaeIII	GGCC	1 cut(s)	653
Hin1II	CATG	6 cut(s)	142, 199, 233, 257, 298, 314
HindIII	AAGCTT	2 cut(s)	106, 486
HinfI	GANTC	3 cut(s)	192, 212, 317
HphI	GGTGA	2 cut(s)	179, 281
Hpy166II	GTNNAC	1 cut(s)	308
Hpy188I	TCNGA	2 cut(s)	100, 480
Hpy188III	TCNNGA	2 cut(s)	33, 112
Hpy8I	GTNNAC	1 cut(s)	308
HpyAV	CCTTC	4 cut(s)	30, 119, 309, 628
HpyCH4III	ACNGT	2 cut(s)	181, 430
HpyCH4V	TGCA	8 cut(s)	86, 176, 233, 344, 366, 375, 549, 560
HpyF10VI	GCNNNNNNNGC	1 cut(s)	372
HpyF3I	CTNAG	4 cut(s)	99, 381, 460, 528
Hsp92II	CATG	6 cut(s)	142, 199, 233, 257, 298, 314
Ksp22I	TGATCA	1 cut(s)	432
Kzo9I	GATC	2 cut(s)	405, 432
LpnPI	CCDG	4 cut(s)	312, 393, 458, 628
Lsp1109I	GCAGC	1 cut(s)	491
LweI	GCATC	1 cut(s)	558
MaeI	CTAG	7 cut(s)	303, 417, 422, 452, 467, 624, 655
MalI	GATC	2 cut(s)	407, 434
MboI	GATC	2 cut(s)	405, 432
MboII	GAAGA	6 cut(s)	199, 275, 278, 312, 457, 493
MhlI	GDGCHC	1 cut(s)	247
MlyI	GAGTC	3 cut(s)	201, 206, 311
MnlI	CCTC	9 cut(s)	7, 38, 94, 177, 376, 448, 506, 523, 576
MroXI	GAANNNNTTC	1 cut(s)	638
MslI	CAYNNNNRTG	1 cut(s)	200
MspA1I	CMGCKG	1 cut(s)	78
Mva1269I	GAATGC	1 cut(s)	178
MwoI	GCNNNNNNNGC	1 cut(s)	372
NdeII	GATC	2 cut(s)	405, 432
NlaIII	CATG	6 cut(s)	142, 199, 233, 257, 298, 314
NspI	RCATGY	2 cut(s)	142, 233
PciI	ACATGT	1 cut(s)	138
PctI	GAATGC	1 cut(s)	178
PdmI	GAANNNNTTC	1 cut(s)	638
PkrI	GCNGC	1 cut(s)	506
PleI	GAGTC	3 cut(s)	200, 206, 311
PpsI	GAGTC	3 cut(s)	200, 206, 311
PpuMI	RGGWCCY	1 cut(s)	413
PscI	ACATGT	1 cut(s)	138
Psp5II	RGGWCCY	1 cut(s)	413
PspPI	GGNCC	1 cut(s)	413
PspPPI	RGGWCCY	1 cut(s)	413
RseI	CAYNNNNRTG	1 cut(s)	200
SatI	GCNGC	1 cut(s)	505
Sau3AI	GATC	2 cut(s)	405, 432
Sau96I	GGNCC	1 cut(s)	413
SchI	GAGTC	3 cut(s)	201, 206, 311
SduI	GDGCHC	1 cut(s)	247
SfaNI	GCATC	1 cut(s)	558
SinI	GGWCC	1 cut(s)	413
SmiMI	CAYNNNNRTG	1 cut(s)	200
SsiI	CCGC	2 cut(s)	78, 150
SspMI	CTAG	7 cut(s)	303, 417, 422, 452, 467, 624, 655
StyI	CCWWGG	1 cut(s)	409
TaaI	ACNGT	2 cut(s)	181, 430
TscAI	CASTG	2 cut(s)	186, 435
TseI	GCWGC	1 cut(s)	504
TspRI	CASTG	2 cut(s)	186, 435
VpaK11BI	GGWCC	1 cut(s)	413
XceI	RCATGY	2 cut(s)	142, 233
XmnI	GAANNNNTTC	1 cut(s)	638
XspI	CTAG	7 cut(s)	303, 417, 422, 452, 467, 624, 655

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.