Rmu_sc0006802.1_g000009

Universal stress protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006802.1
OG0012132
Physical Location & Seq
Reverse (-)
26488 .. 27889
1402 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 657 bp
atgagtgttagggaggcttggaaatcaacttcaagaaggtggggaggtgggaatagcaacccttgtggtggcaacagcggtggtgcaactccacactctgagggaagcttcaagaagcaaatggaagggtttagcaacatgtatggtagcggtggttatggttatggtgagaatgcaacagtgaggaagagagtcatggtggtggtggatgactcatctcattccaaacatgcaatgatgtgggctctcactcatgttgccaacaagggtgatttgcttactcttcttcacatcatgccttctagttcacatggggactcttctgctggttctccataccttgcaaactctcttgggtctctttgcaaggcttgcaagcctgaggttgaagtggaagcacttgtgatccaaggacctagactagccacagtgatcagccaagtgaagaagctagaggtctcagtcctagttctgggtcagaagaaagcttctcccctcattagctgcttatatggaacaagcagaactgaggagtttgtggaacattgcatcaacaatgcagattgcttgactattggagtgaggaagcaaagcaaaggtgtgggtggctatctcatcaacactagatggcagaaggatttctggctcttggcctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Usp

Protein Analysis

218

Amino Acids

23.47

Weight (kDa)

9.14

Isoelectric Point (pI)

45.44

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Usp PF00582 63 - 172 2.3e-10 Universal stress protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012132)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G44760 AT1G44760
fragaria_vesca FvH4_2g26790
malus_domestica MD08G1165100.v1.1 MD15G1350900.v1.1
prunus_persica Prupe.1G499800_v2.0.a1
pyrus_communis pycom15g31340
rosa_chinensis RchiOBHm_Chr6g0295651
rosa_laevigata RLG00000011779
rosa_multiflora Rmu_sc0006802.1_g000009 Rmu_sc0015254.1_g000001
rosa_roxburghii Rroxscaffold_7G00172270
rosa_rugosa Rorug06G0253200 Rorug06G0253200
rosa_samantha Rh6AG366200 Rh6BG374400 Rh6CG380600 Rh6DG367500
rosa_wichuraiana Rw6G031960

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 78, 150
AclWI GGATC 1 cut(s) 400
AfiI CCNNNNNNNGG 2 cut(s) 68, 472
AflIII ACRYGT 1 cut(s) 138
AgsI TTSAA 3 cut(s) 33, 112, 389
AluBI AGCT 4 cut(s) 108, 451, 488, 504
AluI AGCT 4 cut(s) 108, 451, 488, 504
Alw26I GTCTC 2 cut(s) 363, 463
AlwI GGATC 1 cut(s) 400
AoxI GGCC 1 cut(s) 651
ApeKI GCWGC 1 cut(s) 504
Asp700I GAANNNNTTC 1 cut(s) 638
AspS9I GGNCC 1 cut(s) 413
AsuHPI GGTGA 2 cut(s) 179, 281
AvaII GGWCC 1 cut(s) 413
AxyI CCTNAGG 1 cut(s) 381
BanII GRGCYC 1 cut(s) 247
BbvI GCAGC 1 cut(s) 491
BccI CCATC 1 cut(s) 621
BclI TGATCA 1 cut(s) 432
BcoDI GTCTC 2 cut(s) 363, 463
BfaI CTAG 7 cut(s) 303, 417, 422, 452, 467, 624, 655
BisI GCNGC 1 cut(s) 505
BlsI GCNGC 1 cut(s) 506
Bme18I GGWCC 1 cut(s) 413
BmgT120I GGNCC 1 cut(s) 413
BmsI GCATC 1 cut(s) 558
BsaI GGTCTC 2 cut(s) 363, 463
BsaJI CCNNGG 1 cut(s) 409
Bsc4I CCNNNNNNNGG 2 cut(s) 68, 472
Bse21I CCTNAGG 1 cut(s) 381
Bse3DI GCAATG 2 cut(s) 240, 544
BseDI CCNNGG 1 cut(s) 409
BseGI GGATG 1 cut(s) 214
BseLI CCNNNNNNNGG 2 cut(s) 68, 472
BseMI GCAATG 2 cut(s) 240, 544
BseMII CTCAG 4 cut(s) 90, 372, 474, 519
BseRI GAGGAG 1 cut(s) 545
BseXI GCAGC 1 cut(s) 491
BshFI GGCC 1 cut(s) 653
BslFI GGGAC 1 cut(s) 329
BslI CCNNNNNNNGG 2 cut(s) 68, 472
BsmAI GTCTC 2 cut(s) 363, 463
BsmFI GGGAC 1 cut(s) 329
BsmI GAATGC 1 cut(s) 178
BsnI GGCC 1 cut(s) 653
Bso31I GGTCTC 2 cut(s) 363, 463
Bsp1286I GDGCHC 1 cut(s) 247
Bsp143I GATC 2 cut(s) 405, 432
BspACI CCGC 2 cut(s) 78, 150
BspANI GGCC 1 cut(s) 653
BspCNI CTCAG 4 cut(s) 91, 373, 473, 520
BspPI GGATC 1 cut(s) 400
BspTNI GGTCTC 2 cut(s) 363, 463
BsrDI GCAATG 2 cut(s) 240, 544
BssECI CCNNGG 1 cut(s) 409
BssMI GATC 2 cut(s) 405, 432
BssT1I CCWWGG 1 cut(s) 409
Bst4CI ACNGT 2 cut(s) 181, 430
Bst6I CTCTTC 3 cut(s) 182, 288, 325
BstAPI GCANNNNNTGC 1 cut(s) 372
BstC8I GCNNGC 2 cut(s) 373, 377
BstDEI CTNAG 4 cut(s) 99, 381, 460, 528
BstF5I GGATG 1 cut(s) 214
BstKTI GATC 2 cut(s) 408, 435
BstMAI GTCTC 2 cut(s) 363, 463
BstMBI GATC 2 cut(s) 405, 432
BstMWI GCNNNNNNNGC 1 cut(s) 372
BstNSI RCATGY 2 cut(s) 142, 233
BstV1I GCAGC 1 cut(s) 491
Bsu36I CCTNAGG 1 cut(s) 381
BsuRI GGCC 1 cut(s) 653
BtsCI GGATG 1 cut(s) 214
BtsIMutI CAGTG 2 cut(s) 186, 435
Cac8I GCNNGC 2 cut(s) 373, 377
Cfr13I GGNCC 1 cut(s) 413
CspCI CAANNNNNGTGG 4 cut(s) 46, 61, 81, 96
CviAII CATG 6 cut(s) 139, 196, 230, 254, 295, 311
DdeI CTNAG 4 cut(s) 99, 381, 460, 528
DpnI GATC 2 cut(s) 407, 434
DpnII GATC 2 cut(s) 405, 432
Eam1104I CTCTTC 3 cut(s) 182, 288, 325
EarI CTCTTC 3 cut(s) 182, 288, 325
Eco130I CCWWGG 1 cut(s) 409
Eco24I GRGCYC 1 cut(s) 247
Eco31I GGTCTC 2 cut(s) 363, 463
Eco47I GGWCC 1 cut(s) 413
Eco81I CCTNAGG 1 cut(s) 381
EcoO109I RGGNCCY 1 cut(s) 413
EcoT14I CCWWGG 1 cut(s) 409
EcoT38I GRGCYC 1 cut(s) 247
ErhI CCWWGG 1 cut(s) 409
FaeI CATG 6 cut(s) 142, 199, 233, 257, 298, 314
FaqI GGGAC 1 cut(s) 329
FatI CATG 6 cut(s) 138, 195, 229, 253, 294, 310
FbaI TGATCA 1 cut(s) 432
Fnu4HI GCNGC 1 cut(s) 505
FokI GGATG 1 cut(s) 221
FriOI GRGCYC 1 cut(s) 247
Fsp4HI GCNGC 1 cut(s) 505
FspBI CTAG 7 cut(s) 303, 417, 422, 452, 467, 624, 655
GluI GCNGC 1 cut(s) 505
HaeIII GGCC 1 cut(s) 653
Hin1II CATG 6 cut(s) 142, 199, 233, 257, 298, 314
HindIII AAGCTT 2 cut(s) 106, 486
HinfI GANTC 3 cut(s) 192, 212, 317
HphI GGTGA 2 cut(s) 179, 281
Hpy166II GTNNAC 1 cut(s) 308
Hpy188I TCNGA 2 cut(s) 100, 480
Hpy188III TCNNGA 2 cut(s) 33, 112
Hpy8I GTNNAC 1 cut(s) 308
HpyAV CCTTC 4 cut(s) 30, 119, 309, 628
HpyCH4III ACNGT 2 cut(s) 181, 430
HpyCH4V TGCA 8 cut(s) 86, 176, 233, 344, 366, 375, 549, 560
HpyF10VI GCNNNNNNNGC 1 cut(s) 372
HpyF3I CTNAG 4 cut(s) 99, 381, 460, 528
Hsp92II CATG 6 cut(s) 142, 199, 233, 257, 298, 314
Ksp22I TGATCA 1 cut(s) 432
Kzo9I GATC 2 cut(s) 405, 432
LpnPI CCDG 4 cut(s) 312, 393, 458, 628
Lsp1109I GCAGC 1 cut(s) 491
LweI GCATC 1 cut(s) 558
MaeI CTAG 7 cut(s) 303, 417, 422, 452, 467, 624, 655
MalI GATC 2 cut(s) 407, 434
MboI GATC 2 cut(s) 405, 432
MboII GAAGA 6 cut(s) 199, 275, 278, 312, 457, 493
MhlI GDGCHC 1 cut(s) 247
MlyI GAGTC 3 cut(s) 201, 206, 311
MnlI CCTC 9 cut(s) 7, 38, 94, 177, 376, 448, 506, 523, 576
MroXI GAANNNNTTC 1 cut(s) 638
MslI CAYNNNNRTG 1 cut(s) 200
MspA1I CMGCKG 1 cut(s) 78
Mva1269I GAATGC 1 cut(s) 178
MwoI GCNNNNNNNGC 1 cut(s) 372
NdeII GATC 2 cut(s) 405, 432
NlaIII CATG 6 cut(s) 142, 199, 233, 257, 298, 314
NspI RCATGY 2 cut(s) 142, 233
PciI ACATGT 1 cut(s) 138
PctI GAATGC 1 cut(s) 178
PdmI GAANNNNTTC 1 cut(s) 638
PkrI GCNGC 1 cut(s) 506
PleI GAGTC 3 cut(s) 200, 206, 311
PpsI GAGTC 3 cut(s) 200, 206, 311
PpuMI RGGWCCY 1 cut(s) 413
PscI ACATGT 1 cut(s) 138
Psp5II RGGWCCY 1 cut(s) 413
PspPI GGNCC 1 cut(s) 413
PspPPI RGGWCCY 1 cut(s) 413
RseI CAYNNNNRTG 1 cut(s) 200
SatI GCNGC 1 cut(s) 505
Sau3AI GATC 2 cut(s) 405, 432
Sau96I GGNCC 1 cut(s) 413
SchI GAGTC 3 cut(s) 201, 206, 311
SduI GDGCHC 1 cut(s) 247
SfaNI GCATC 1 cut(s) 558
SinI GGWCC 1 cut(s) 413
SmiMI CAYNNNNRTG 1 cut(s) 200
SsiI CCGC 2 cut(s) 78, 150
SspMI CTAG 7 cut(s) 303, 417, 422, 452, 467, 624, 655
StyI CCWWGG 1 cut(s) 409
TaaI ACNGT 2 cut(s) 181, 430
TscAI CASTG 2 cut(s) 186, 435
TseI GCWGC 1 cut(s) 504
TspRI CASTG 2 cut(s) 186, 435
VpaK11BI GGWCC 1 cut(s) 413
XceI RCATGY 2 cut(s) 142, 233
XmnI GAANNNNTTC 1 cut(s) 638
XspI CTAG 7 cut(s) 303, 417, 422, 452, 467, 624, 655
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.