Rmu_sc0007276.1_g000001

SET (Su(var)3-9, Enhancer-of-zeste, Trithorax) domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007276.1
Physical Location & Seq
Forward (+)
11 .. 751
741 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007276.1_g000001.1.cds

Sequence Viewer

Length: 741 bp
atgaggaagtcggggattagagggcgtggtttgtttgcgacgaagaatatggaagctgggagtttggtgctgattaataaagctgttgcaacggagagaggtatcttgccgggtcaagatttggatgagaatgcccaattagttatgtggaagacttttactgaaacagtgatggattccgtggccaaatgttcgagaacatgtggtttgattagtactttgtcgagtggtgaagatgaggatgggcttgaggtgcctgagattaatctgtttaagcctgtttcggagcactttgggtactcaaatgagaagaagcttgatgtgagtaggattttaagtattttggatgtcaattcgattgttgaggattcgatttcgtcaaaggttttggggaagaacagtgattactatggtgttgggctttgggtacttgcttcatttatcaaccattcatgtattcccaatgcaaggcgtttgcatgttggggactatgtgattgttcatgcttcaagagatgtcaaggctggtgaggagctaacatttgcatattttgatgtgctgaacccgttggaaaagcgcaacgaaatgtcaaagacttgggggtttaggtgcaactgcaggaggtgtaagtttgaggctgaactatgttcgaggcaagaaggcattggagaattaataaagctgttgcaacggagagaggtattttgccgggtcaagatttggatgagaatgcccaattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

246

Amino Acids

27.76

Weight (kDa)

8.08

Isoelectric Point (pI)

39.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018938)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 253
AcoI YGGCCR 1 cut(s) 183
AfaI GTAC 3 cut(s) 217, 299, 429
AfiI CCNNNNNNNGG 1 cut(s) 468
AflIII ACRYGT 1 cut(s) 200
AgsI TTSAA 1 cut(s) 510
AluBI AGCT 5 cut(s) 56, 83, 316, 535, 682
AluI AGCT 5 cut(s) 56, 83, 316, 535, 682
Alw21I GWGCWC 1 cut(s) 291
AoxI GGCC 1 cut(s) 183
AseI ATTAAT 3 cut(s) 75, 264, 674
AspLEI GCGC 1 cut(s) 579
AsuC2I CCSGG 2 cut(s) 111, 710
AsuHPI GGTGA 2 cut(s) 242, 539
BalI TGGCCA 1 cut(s) 185
BanI GGYRCC 1 cut(s) 253
BbsI GAAGAC 1 cut(s) 158
Bbv12I GWGCWC 1 cut(s) 291
BccI CCATC 2 cut(s) 166, 236
BcnI CCSGG 2 cut(s) 111, 710
BfmI CTRYAG 1 cut(s) 616
BmcAI AGTACT 1 cut(s) 217
Bme1390I CCNGG 2 cut(s) 111, 710
BmiI GGNNCC 1 cut(s) 255
BmrFI CCNGG 2 cut(s) 111, 710
BpiI GAAGAC 1 cut(s) 158
BpuEI CTTGAG 1 cut(s) 269
BpuMI CCSGG 2 cut(s) 111, 710
BsaJI CCNNGG 1 cut(s) 180
Bsc4I CCNNNNNNNGG 1 cut(s) 468
BseDI CCNNGG 1 cut(s) 180
BseGI GGATG 4 cut(s) 130, 247, 352, 729
BseLI CCNNNNNNNGG 1 cut(s) 468
BseMII CTCAG 1 cut(s) 249
BseRI GAGGAG 1 cut(s) 545
BseYI CCCAGC 1 cut(s) 56
BshFI GGCC 1 cut(s) 185
BshNI GGYRCC 1 cut(s) 253
BsiHKAI GWGCWC 1 cut(s) 291
BsiSI CCGG 2 cut(s) 110, 709
BslFI GGGAC 1 cut(s) 500
BslI CCNNNNNNNGG 1 cut(s) 468
BsmFI GGGAC 1 cut(s) 500
BsmI GAATGC 2 cut(s) 136, 735
BsnI GGCC 1 cut(s) 185
Bsp1286I GDGCHC 1 cut(s) 291
BspANI GGCC 1 cut(s) 185
BspCNI CTCAG 1 cut(s) 250
BspLI GGNNCC 1 cut(s) 255
BspMAI CTGCAG 1 cut(s) 620
BspT107I GGYRCC 1 cut(s) 253
BssECI CCNNGG 1 cut(s) 180
Bst4CI ACNGT 2 cut(s) 169, 401
BstDEI CTNAG 1 cut(s) 258
BstDSI CCRYGG 1 cut(s) 180
BstF5I GGATG 4 cut(s) 130, 247, 352, 729
BstHHI GCGC 1 cut(s) 579
BstMWI GCNNNNNNNGC 1 cut(s) 253
BstNSI RCATGY 2 cut(s) 204, 482
BstSCI CCNGG 2 cut(s) 109, 708
BstSFI CTRYAG 1 cut(s) 616
BstV2I GAAGAC 1 cut(s) 158
BsuRI GGCC 1 cut(s) 185
BtgI CCRYGG 1 cut(s) 180
BtsCI GGATG 4 cut(s) 130, 247, 352, 729
BtsIMutI CAGTG 2 cut(s) 174, 406
CfoI GCGC 1 cut(s) 579
Csp6I GTAC 3 cut(s) 216, 298, 428
CviAII CATG 4 cut(s) 201, 453, 479, 503
CviQI GTAC 3 cut(s) 216, 298, 428
DdeI CTNAG 1 cut(s) 258
EaeI YGGCCR 1 cut(s) 183
FaeI CATG 4 cut(s) 204, 456, 482, 506
FaqI GGGAC 1 cut(s) 500
FatI CATG 4 cut(s) 200, 452, 478, 502
FokI GGATG 4 cut(s) 137, 254, 359, 736
GlaI GCGC 1 cut(s) 578
GsaI CCCAGC 1 cut(s) 60
HaeIII GGCC 1 cut(s) 185
HapII CCGG 2 cut(s) 110, 709
HhaI GCGC 1 cut(s) 579
Hin1II CATG 4 cut(s) 204, 456, 482, 506
Hin6I GCGC 1 cut(s) 577
HinP1I GCGC 1 cut(s) 577
HindIII AAGCTT 1 cut(s) 314
HinfI GANTC 2 cut(s) 176, 368
HpaII CCGG 2 cut(s) 110, 709
HphI GGTGA 2 cut(s) 242, 539
Hpy188I TCNGA 1 cut(s) 286
Hpy188III TCNNGA 4 cut(s) 116, 195, 510, 715
Hpy99I CGWCG 1 cut(s) 43
HpyAV CCTTC 1 cut(s) 653
HpyCH4III ACNGT 2 cut(s) 169, 401
HpyCH4V TGCA 7 cut(s) 89, 467, 478, 545, 612, 618, 688
HpyF10VI GCNNNNNNNGC 1 cut(s) 253
HpyF3I CTNAG 1 cut(s) 258
Hsp92II CATG 4 cut(s) 204, 456, 482, 506
HspAI GCGC 1 cut(s) 577
LmnI GCTCC 2 cut(s) 286, 532
LpnPI CCDG 7 cut(s) 42, 123, 270, 291, 510, 604, 722
MboII GAAGA 5 cut(s) 55, 163, 245, 322, 406
MhlI GDGCHC 1 cut(s) 291
MlsI TGGCCA 1 cut(s) 185
MluCI AATT 4 cut(s) 137, 352, 671, 736
MluNI TGGCCA 1 cut(s) 185
MmeI TCCRAC 1 cut(s) 549
Mox20I TGGCCA 1 cut(s) 185
MscI TGGCCA 1 cut(s) 185
MseI TTAA 5 cut(s) 75, 264, 273, 335, 674
Msp20I TGGCCA 1 cut(s) 185
MspI CCGG 2 cut(s) 110, 709
MspR9I CCNGG 2 cut(s) 111, 710
Mva1269I GAATGC 2 cut(s) 136, 735
MwoI GCNNNNNNNGC 1 cut(s) 253
NciI CCSGG 2 cut(s) 111, 710
NlaIII CATG 4 cut(s) 204, 456, 482, 506
NlaIV GGNNCC 1 cut(s) 255
NspI RCATGY 2 cut(s) 204, 482
PciI ACATGT 1 cut(s) 200
PctI GAATGC 2 cut(s) 136, 735
PfeI GAWTC 2 cut(s) 176, 368
PscI ACATGT 1 cut(s) 200
PshBI ATTAAT 3 cut(s) 75, 264, 674
PspFI CCCAGC 1 cut(s) 56
PspN4I GGNNCC 1 cut(s) 255
PsrI GAACNNNNNNTAC 2 cut(s) 389, 421
PstI CTGCAG 1 cut(s) 620
RsaI GTAC 3 cut(s) 217, 299, 429
RsaNI GTAC 3 cut(s) 216, 298, 428
SaqAI TTAA 5 cut(s) 75, 264, 273, 335, 674
ScaI AGTACT 1 cut(s) 217
ScrFI CCNGG 2 cut(s) 111, 710
SduI GDGCHC 1 cut(s) 291
SfcI CTRYAG 1 cut(s) 616
SmlI CTYRAG 1 cut(s) 248
SmoI CTYRAG 1 cut(s) 248
Sse9I AATT 4 cut(s) 137, 352, 671, 736
StyD4I CCNGG 2 cut(s) 109, 708
TaaI ACNGT 2 cut(s) 169, 401
TaqI TCGA 5 cut(s) 194, 224, 356, 371, 650
TasI AATT 4 cut(s) 137, 352, 671, 736
TatI WGTACW 1 cut(s) 215
TfiI GAWTC 2 cut(s) 176, 368
Tru1I TTAA 5 cut(s) 75, 264, 273, 335, 674
Tru9I TTAA 5 cut(s) 75, 264, 273, 335, 674
TscAI CASTG 2 cut(s) 174, 406
TspDTI ATGAA 3 cut(s) 426, 441, 491
TspGWI ACGGA 3 cut(s) 107, 169, 706
TspRI CASTG 2 cut(s) 174, 406
VspI ATTAAT 3 cut(s) 75, 264, 674
XceI RCATGY 2 cut(s) 204, 482
ZrmI AGTACT 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.