Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007437.1

Orthogroup ID

OG0016244

Physical Location & Seq

Genomic Coordinates Reverse (-)

1578 .. 3214

Gene Structure 1637 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007437.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1074 bp

atgacgtcgaacccgaagagcgagacggacttggccttggacgccggagcgacccgccggctctacccgtccatgtttgagagcccggagctccgctgggccttcattcgcaaagtctacgccatcctcaccgtccagctactcctcacagtcgccgtcgccgccaccgtcgatttagtccgtccgattgctcacttccttgtcaaaacccgcgccggcttgggcgtcgacatcgccgtcttcgtcatggccctcgccggatcgatgacgtcgaacccgaagagcgagacggacttggccttggacgccggagcgacccgccggctctacccgtccatgtttgagagcccggagctccgctgggccttcattcgcaaagtctacgccatcctcaccgtccagctactcctcacagtcgccgtcgccgccaccgtcgatttagtccgtccgattgctcacttccttgtcaaaacccgcgccggcttaggcgtcgacatcgccgtcttcgtcatggccctcgccggtaattctttctccgtaaagatggcttctttagggttttttgctgtggaaattagggtttcggtgtttgacttaattgcagtgttggtggctttgagagtttacggcaagaagcacccggtgaattacctcttgattgggcttttcacagtcttaatgggactcatagtcggagtgggttgtgcttatactgaagagaaggtacttttggaggcttggggtctgaccattgtgattttcatgagcttgactatctatacattctgggctgcaaggagaggctatgatttcagcttccttggtccttttctgtttgcagctctgattgttctgcttggatttagtctgattcagatcctccatcctctggggaaaaccagtcatatgatattgggcattgtgggatgtatcatcttctgtggctacattgtctatgatacggatgagctgatcaagcgccaccagtatgatgagtacatgttggctgcaatccagctctacttggatgctatcaacctcttcctgaatttgatcacagctattgatagctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Bax1-I

Protein Analysis

357

Amino Acids

39.35

Weight (kDa)

8.33

Isoelectric Point (pI)

31.28

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016244)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g22950 FvH4_2g23070 FvH4_4g33780 FvH4_6g44540
rosa_chinensis	RchiOBHm_Chr6g0290181 RchiOBHm_Chr6g0290191
rosa_laevigata	RLG00000012235
rosa_multiflora	Rmu_sc0002902.1_g000016 Rmu_sc0007437.1_g000002
rosa_roxburghii	Rroxscaffold_7G00177270
rosa_rugosa	Rorug06G0210600
rosa_samantha	Rh6AG321200 Rh6BG328300 Rh6DG321300
rosa_wichuraiana	Rw6G027740

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	2 cut(s)	236, 500
AatII	GACGTC	2 cut(s)	8, 272
AccB7I	CCANNNNNTGG	1 cut(s)	889
AccI	GTMKAC	4 cut(s)	117, 228, 381, 492
AccII	CGCG	2 cut(s)	213, 477
AciI	CCGC	8 cut(s)	55, 94, 162, 211, 319, 358, 426, 475
AclWI	GGATC	2 cut(s)	268, 871
AcsI	RAATTY	1 cut(s)	1048
AcuI	CTGAAG	1 cut(s)	735
AcyI	GRCGYC	6 cut(s)	5, 42, 225, 269, 306, 489
AdeI	CACNNNGTG	1 cut(s)	643
AfaI	GTAC	2 cut(s)	726, 998
AfiI	CCNNNNNNNGG	1 cut(s)	889
AflIII	ACRYGT	1 cut(s)	999
AhdI	GACNNNNNGTC	1 cut(s)	689
AjuI	GAANNNNNNNTTGG	2 cut(s)	713, 745
Alw21I	GWGCWC	2 cut(s)	93, 357
Alw26I	GTCTC	2 cut(s)	17, 281
AlwI	GGATC	2 cut(s)	268, 871
AoxI	GGCC	6 cut(s)	33, 99, 249, 297, 363, 513
ApeKI	GCWGC	3 cut(s)	791, 839, 1007
ApoI	RAATTY	1 cut(s)	1048
AspLEI	GCGC	3 cut(s)	215, 479, 981
AspS9I	GGNCC	5 cut(s)	99, 250, 363, 514, 824
AsuC2I	CCSGG	3 cut(s)	86, 350, 641
AsuHPI	GGTGA	3 cut(s)	121, 385, 655
AvaII	GGWCC	1 cut(s)	824
BanII	GRGCYC	4 cut(s)	86, 93, 350, 357
BarI	GAAGNNNNNNTAC	2 cut(s)	708, 740
BbsI	GAAGAC	2 cut(s)	232, 496
Bbv12I	GWGCWC	2 cut(s)	93, 357
BbvI	GCAGC	3 cut(s)	778, 851, 994
BccI	CCATC	4 cut(s)	131, 395, 538, 891
BceAI	ACGGC	5 cut(s)	140, 221, 404, 485, 643
BclI	TGATCA	2 cut(s)	972, 1053
BcnI	CCSGG	3 cut(s)	86, 350, 641
BcoDI	GTCTC	2 cut(s)	17, 281
BfoI	RGCGCY	1 cut(s)	982
BisI	GCNGC	5 cut(s)	162, 426, 792, 840, 1008
BlsI	GCNGC	5 cut(s)	163, 427, 793, 841, 1009
Bme1390I	CCNGG	3 cut(s)	86, 350, 641
Bme18I	GGWCC	1 cut(s)	824
BmeRI	GACNNNNNGTC	1 cut(s)	689
BmgT120I	GGNCC	5 cut(s)	99, 250, 363, 514, 824
BmrFI	CCNGG	3 cut(s)	86, 350, 641
BmsI	GCATC	1 cut(s)	1018
BpiI	GAAGAC	2 cut(s)	232, 496
Bpu10I	CCTNAGC	1 cut(s)	484
BpuMI	CCSGG	3 cut(s)	86, 350, 641
Bsa29I	ATCGAT	1 cut(s)	263
BsaBI	GATNNNNATC	1 cut(s)	875
BsaHI	GRCGYC	6 cut(s)	5, 42, 225, 269, 306, 489
BsaJI	CCNNGG	3 cut(s)	36, 300, 820
Bsc4I	CCNNNNNNNGG	1 cut(s)	889
Bse118I	RCCGGY	5 cut(s)	57, 215, 321, 479, 521
Bse1I	ACTGG	2 cut(s)	900, 985
Bse8I	GATNNNNATC	1 cut(s)	875
BseCI	ATCGAT	1 cut(s)	263
BseDI	CCNNGG	3 cut(s)	36, 300, 820
BseGI	GGATG	6 cut(s)	123, 387, 883, 932, 970, 1033
BseJI	GATNNNNATC	1 cut(s)	875
BseLI	CCNNNNNNNGG	1 cut(s)	889
BseNI	ACTGG	2 cut(s)	900, 985
BseRI	GAGGAG	2 cut(s)	134, 398
BseXI	GCAGC	3 cut(s)	778, 851, 994
BseYI	CCCAGC	2 cut(s)	96, 360
Bsh1236I	CGCG	2 cut(s)	213, 477
BshFI	GGCC	6 cut(s)	35, 101, 251, 299, 365, 515
BshVI	ATCGAT	1 cut(s)	263
BsiHKAI	GWGCWC	2 cut(s)	93, 357
BslFI	GGGAC	1 cut(s)	696
BslI	CCNNNNNNNGG	1 cut(s)	889
BsmAI	GTCTC	2 cut(s)	17, 281
BsmBI	CGTCTC	2 cut(s)	17, 281
BsmFI	GGGAC	1 cut(s)	696
BsnI	GGCC	6 cut(s)	35, 101, 251, 299, 365, 515
Bsp1286I	GDGCHC	4 cut(s)	86, 93, 350, 357
Bsp143I	GATC	4 cut(s)	260, 876, 972, 1053
BspACI	CCGC	8 cut(s)	55, 94, 162, 211, 319, 358, 426, 475
BspANI	GGCC	6 cut(s)	35, 101, 251, 299, 365, 515
BspDI	ATCGAT	1 cut(s)	263
BspFNI	CGCG	2 cut(s)	213, 477
BspHI	TCATGA	1 cut(s)	762
BspPI	GGATC	2 cut(s)	268, 871
BspQI	GCTCTTC	2 cut(s)	11, 275
BsrFI	RCCGGY	5 cut(s)	57, 215, 321, 479, 521
BsrI	ACTGG	2 cut(s)	900, 985
BssAI	RCCGGY	5 cut(s)	57, 215, 321, 479, 521
BssECI	CCNNGG	3 cut(s)	36, 300, 820
BssMI	GATC	4 cut(s)	260, 876, 972, 1053
BssNI	GRCGYC	6 cut(s)	5, 42, 225, 269, 306, 489
BssT1I	CCWWGG	3 cut(s)	36, 300, 820
Bst4CI	ACNGT	7 cut(s)	133, 151, 169, 397, 415, 433, 673
Bst6I	CTCTTC	4 cut(s)	11, 275, 711, 1046
BstACI	GRCGYC	6 cut(s)	5, 42, 225, 269, 306, 489
BstC8I	GCNNGC	4 cut(s)	59, 217, 323, 481
BstDEI	CTNAG	1 cut(s)	484
BstF5I	GGATG	6 cut(s)	123, 387, 883, 932, 970, 1033
BstFNI	CGCG	2 cut(s)	213, 477
BstH2I	RGCGCY	1 cut(s)	982
BstHHI	GCGC	3 cut(s)	215, 479, 981
BstKTI	GATC	4 cut(s)	263, 879, 975, 1056
BstMAI	GTCTC	2 cut(s)	17, 281
BstMBI	GATC	4 cut(s)	260, 876, 972, 1053
BstMWI	GCNNNNNNNGC	5 cut(s)	41, 161, 305, 425, 976
BstNSI	RCATGY	1 cut(s)	1003
BstSCI	CCNGG	3 cut(s)	84, 348, 639
BstUI	CGCG	2 cut(s)	213, 477
BstV1I	GCAGC	3 cut(s)	778, 851, 994
BstV2I	GAAGAC	2 cut(s)	232, 496
BstX2I	RGATCY	1 cut(s)	876
BstYI	RGATCY	1 cut(s)	876
Bsu15I	ATCGAT	1 cut(s)	263
BsuRI	GGCC	6 cut(s)	35, 101, 251, 299, 365, 515
BsuTUI	ATCGAT	1 cut(s)	263
BtgZI	GCGATG	2 cut(s)	217, 481
BtsCI	GGATG	6 cut(s)	123, 387, 883, 932, 970, 1033
BtsI	GCAGTG	1 cut(s)	609
BtsIMutI	CAGTG	1 cut(s)	609
Cac8I	GCNNGC	4 cut(s)	59, 217, 323, 481
CciI	TCATGA	1 cut(s)	762
CfoI	GCGC	3 cut(s)	215, 479, 981
Cfr10I	RCCGGY	5 cut(s)	57, 215, 321, 479, 521
Cfr13I	GGNCC	5 cut(s)	99, 250, 363, 514, 824
ClaI	ATCGAT	1 cut(s)	263
CseI	GACGC	4 cut(s)	50, 214, 314, 478
Csp6I	GTAC	2 cut(s)	725, 997
CviAII	CATG	6 cut(s)	73, 247, 337, 511, 763, 1000
CviQI	GTAC	2 cut(s)	725, 997
DdeI	CTNAG	1 cut(s)	484
DpnI	GATC	4 cut(s)	262, 878, 974, 1055
DpnII	GATC	4 cut(s)	260, 876, 972, 1053
DraIII	CACNNNGTG	1 cut(s)	643
DrdI	GACNNNNNNGTC	2 cut(s)	236, 500
DriI	GACNNNNNGTC	1 cut(s)	689
DseDI	GACNNNNNNGTC	2 cut(s)	236, 500
Eam1104I	CTCTTC	4 cut(s)	11, 275, 711, 1046
Eam1105I	GACNNNNNGTC	1 cut(s)	689
EarI	CTCTTC	4 cut(s)	11, 275, 711, 1046
Ecl136II	GAGCTC	2 cut(s)	91, 355
Eco130I	CCWWGG	3 cut(s)	36, 300, 820
Eco24I	GRGCYC	4 cut(s)	86, 93, 350, 357
Eco47I	GGWCC	1 cut(s)	824
Eco53kI	GAGCTC	2 cut(s)	91, 355
Eco57I	CTGAAG	1 cut(s)	735
EcoICRI	GAGCTC	2 cut(s)	91, 355
EcoT14I	CCWWGG	3 cut(s)	36, 300, 820
EcoT38I	GRGCYC	4 cut(s)	86, 93, 350, 357
ErhI	CCWWGG	3 cut(s)	36, 300, 820
Esp3I	CGTCTC	2 cut(s)	17, 281
FaeI	CATG	6 cut(s)	76, 250, 340, 514, 766, 1003
FaqI	GGGAC	1 cut(s)	696
FatI	CATG	6 cut(s)	72, 246, 336, 510, 762, 999
FauI	CCCGC	4 cut(s)	62, 218, 326, 482
FauNDI	CATATG	1 cut(s)	906
FbaI	TGATCA	2 cut(s)	972, 1053
FblI	GTMKAC	4 cut(s)	117, 228, 381, 492
Fnu4HI	GCNGC	5 cut(s)	162, 426, 792, 840, 1008
FokI	GGATG	6 cut(s)	110, 374, 870, 939, 977, 1040
FriOI	GRGCYC	4 cut(s)	86, 93, 350, 357
Fsp4HI	GCNGC	5 cut(s)	162, 426, 792, 840, 1008
GlaI	GCGC	3 cut(s)	214, 478, 980
GluI	GCNGC	5 cut(s)	162, 426, 792, 840, 1008
GsaI	CCCAGC	2 cut(s)	100, 364
HaeII	RGCGCY	1 cut(s)	982
HaeIII	GGCC	6 cut(s)	35, 101, 251, 299, 365, 515
HgaI	GACGC	4 cut(s)	50, 214, 314, 478
HhaI	GCGC	3 cut(s)	215, 479, 981
Hin1I	GRCGYC	6 cut(s)	5, 42, 225, 269, 306, 489
Hin1II	CATG	6 cut(s)	76, 250, 340, 514, 766, 1003
Hin6I	GCGC	3 cut(s)	213, 477, 979
HinP1I	GCGC	3 cut(s)	213, 477, 979
HincII	GTYRAC	2 cut(s)	229, 493
HindII	GTYRAC	2 cut(s)	229, 493
HinfI	GANTC	2 cut(s)	684, 871
HphI	GGTGA	3 cut(s)	121, 385, 655
Hpy166II	GTNNAC	5 cut(s)	118, 229, 382, 493, 625
Hpy188I	TCNGA	7 cut(s)	186, 450, 695, 747, 846, 870, 876
Hpy188III	TCNNGA	3 cut(s)	655, 763, 1045
Hpy8I	GTNNAC	5 cut(s)	118, 229, 382, 493, 625
Hpy99I	CGWCG	8 cut(s)	10, 161, 173, 230, 274, 425, 437, 494
HpyAV	CCTTC	3 cut(s)	112, 376, 715
HpyCH4III	ACNGT	7 cut(s)	133, 151, 169, 397, 415, 433, 673
HpyCH4IV	ACGT	2 cut(s)	5, 269
HpyCH4V	TGCA	4 cut(s)	602, 794, 839, 1010
HpyF10VI	GCNNNNNNNGC	5 cut(s)	41, 161, 305, 425, 976
HpyF3I	CTNAG	1 cut(s)	484
HpySE526I	ACGT	2 cut(s)	5, 269
Hsp92I	GRCGYC	6 cut(s)	5, 42, 225, 269, 306, 489
Hsp92II	CATG	6 cut(s)	76, 250, 340, 514, 766, 1003
HspAI	GCGC	3 cut(s)	213, 477, 979
KroI	GCCGGC	4 cut(s)	57, 215, 321, 479
KroNI	GCCGGC	4 cut(s)	59, 217, 323, 481
Ksp22I	TGATCA	2 cut(s)	972, 1053
Kzo9I	GATC	4 cut(s)	260, 876, 972, 1053
LguI	GCTCTTC	2 cut(s)	11, 275
LmnI	GCTCC	6 cut(s)	47, 88, 96, 311, 352, 360
Lsp1109I	GCAGC	3 cut(s)	778, 851, 994
LweI	GCATC	1 cut(s)	1018
MaeII	ACGT	2 cut(s)	5, 269
MalI	GATC	4 cut(s)	262, 878, 974, 1055
MboI	GATC	4 cut(s)	260, 876, 972, 1053
MboII	GAAGA	7 cut(s)	28, 232, 292, 496, 728, 928, 1033
MflI	RGATCY	1 cut(s)	876
MhlI	GDGCHC	4 cut(s)	86, 93, 350, 357
MluCI	AATT	5 cut(s)	526, 573, 597, 646, 1048
MlyI	GAGTC	1 cut(s)	678
MmeI	TCCRAC	1 cut(s)	673
MroNI	GCCGGC	4 cut(s)	57, 215, 321, 479
MseI	TTAA	2 cut(s)	596, 677
MslI	CAYNNNNRTG	1 cut(s)	987
MspA1I	CMGCKG	2 cut(s)	96, 360
MspR9I	CCNGG	3 cut(s)	86, 350, 641
MvnI	CGCG	2 cut(s)	213, 477
MwoI	GCNNNNNNNGC	5 cut(s)	41, 161, 305, 425, 976
NaeI	GCCGGC	4 cut(s)	59, 217, 323, 481
NciI	CCSGG	3 cut(s)	86, 350, 641
NdeI	CATATG	1 cut(s)	906
NdeII	GATC	4 cut(s)	260, 876, 972, 1053
NgoMIV	GCCGGC	4 cut(s)	57, 215, 321, 479
NlaIII	CATG	6 cut(s)	76, 250, 340, 514, 766, 1003
NspI	RCATGY	1 cut(s)	1003
PagI	TCATGA	1 cut(s)	762
PciI	ACATGT	1 cut(s)	999
PciSI	GCTCTTC	2 cut(s)	11, 275
PcsI	WCGNNNNNNNCGW	9 cut(s)	11, 165, 234, 240, 269, 275, 429, 498, 504
PdiI	GCCGGC	4 cut(s)	59, 217, 323, 481
PfeI	GAWTC	1 cut(s)	871
PflMI	CCANNNNNTGG	1 cut(s)	889
PkrI	GCNGC	5 cut(s)	163, 427, 793, 841, 1009
PleI	GAGTC	1 cut(s)	678
PpsI	GAGTC	1 cut(s)	678
PscI	ACATGT	1 cut(s)	999
Psp124BI	GAGCTC	2 cut(s)	93, 357
PspFI	CCCAGC	2 cut(s)	96, 360
PspPI	GGNCC	5 cut(s)	99, 250, 363, 514, 824
PsuI	RGATCY	1 cut(s)	876
RsaI	GTAC	2 cut(s)	726, 998
RsaNI	GTAC	2 cut(s)	725, 997
RseI	CAYNNNNRTG	1 cut(s)	987
SacI	GAGCTC	2 cut(s)	93, 357
SalI	GTCGAC	2 cut(s)	227, 491
SapI	GCTCTTC	2 cut(s)	11, 275
SaqAI	TTAA	2 cut(s)	596, 677
SatI	GCNGC	5 cut(s)	162, 426, 792, 840, 1008
Sau3AI	GATC	4 cut(s)	260, 876, 972, 1053
Sau96I	GGNCC	5 cut(s)	99, 250, 363, 514, 824
SchI	GAGTC	1 cut(s)	678
ScrFI	CCNGG	3 cut(s)	86, 350, 641
SduI	GDGCHC	4 cut(s)	86, 93, 350, 357
SfaNI	GCATC	1 cut(s)	1018
SinI	GGWCC	1 cut(s)	824
SmiMI	CAYNNNNRTG	1 cut(s)	987
Sse9I	AATT	5 cut(s)	526, 573, 597, 646, 1048
SsiI	CCGC	8 cut(s)	55, 94, 162, 211, 319, 358, 426, 475
SstI	GAGCTC	2 cut(s)	93, 357
StyD4I	CCNGG	3 cut(s)	84, 348, 639
StyI	CCWWGG	3 cut(s)	36, 300, 820
TaaI	ACNGT	7 cut(s)	133, 151, 169, 397, 415, 433, 673
TaiI	ACGT	2 cut(s)	8, 272
TaqI	TCGA	7 cut(s)	8, 171, 228, 263, 272, 435, 492
TasI	AATT	5 cut(s)	526, 573, 597, 646, 1048
TatI	WGTACW	1 cut(s)	996
TauI	GCSGC	2 cut(s)	164, 428
TfiI	GAWTC	1 cut(s)	871
Tru1I	TTAA	2 cut(s)	596, 677
Tru9I	TTAA	2 cut(s)	596, 677
TscAI	CASTG	1 cut(s)	609
TseI	GCWGC	3 cut(s)	791, 839, 1007
TspDTI	ATGAA	3 cut(s)	94, 358, 751
TspGWI	ACGGA	6 cut(s)	41, 170, 305, 434, 526, 977
TspRI	CASTG	1 cut(s)	609
Van91I	CCANNNNNTGG	1 cut(s)	889
VpaK11BI	GGWCC	1 cut(s)	824
XapI	RAATTY	1 cut(s)	1048
XceI	RCATGY	1 cut(s)	1003
XmiI	GTMKAC	4 cut(s)	117, 228, 381, 492
ZraI	GACGTC	2 cut(s)	6, 270

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.