Rmu_sc0007533.1_g000007

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007533.1
Physical Location & Seq
Reverse (-)
13178 .. 15336
2159 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007533.1_g000007.1.cds

Sequence Viewer

Length: 456 bp
atggccagtcggccgtctccgtcgtctccaccgtcctctgcttccaactccgaccactcccccactcaacccccctctctcactcccacaaatccacacgcacaggccgaggctggaatcaacaatggggttctcaatgtcgacgagaaaaagcctgcatcttttgatgagcttcataccgcagaccacatccagaagttcaagaagtatgaagctgactacactcgttggttgactgcaaaatacttctccaagaaaactctttatggaggcaacatatttgatgaaaatatgataatacaggatgaggttataaagtcaagcaggtggccttgtaccaggtcatatgcagacccagtgcagggctttgaagaccagaccagcagctgctcaccttctacaactacagccgaaacctcacctaacttatcaaatgggaagcatccagtaaagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

151

Amino Acids

16.57

Weight (kDa)

6.18

Isoelectric Point (pI)

63.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 314
AarI CACCTGC 1 cut(s) 315
Acc36I ACCTGC 1 cut(s) 315
AccI GTMKAC 1 cut(s) 141
AciI CCGC 1 cut(s) 180
AcoI YGGCCR 2 cut(s) 3, 11
AfaI GTAC 1 cut(s) 337
AfiI CCNNNNNNNGG 2 cut(s) 361, 362
AgsI TTSAA 2 cut(s) 202, 371
AjnI CCWGG 1 cut(s) 338
AluBI AGCT 3 cut(s) 172, 215, 387
AluI AGCT 3 cut(s) 172, 215, 387
Alw26I GTCTC 2 cut(s) 21, 30
AlwNI CAGNNNCTG 1 cut(s) 387
AoxI GGCC 4 cut(s) 3, 11, 105, 329
ApeKI GCWGC 2 cut(s) 384, 387
AsuHPI GGTGA 2 cut(s) 384, 411
BalI TGGCCA 1 cut(s) 5
BbsI GAAGAC 1 cut(s) 378
BbvI GCAGC 2 cut(s) 374, 396
BciT130I CCWGG 1 cut(s) 340
BcoDI GTCTC 2 cut(s) 21, 30
BfmI CTRYAG 1 cut(s) 405
BfuAI ACCTGC 1 cut(s) 315
BisI GCNGC 2 cut(s) 385, 388
BlsI GCNGC 2 cut(s) 386, 389
Bme1390I CCNGG 1 cut(s) 340
BmrFI CCNGG 1 cut(s) 340
BmrI ACTGGG 1 cut(s) 350
BmsI GCATC 2 cut(s) 167, 451
BmuI ACTGGG 1 cut(s) 350
BpiI GAAGAC 1 cut(s) 378
BsaJI CCNNGG 1 cut(s) 108
Bsc4I CCNNNNNNNGG 2 cut(s) 361, 362
Bse1I ACTGG 3 cut(s) 6, 356, 446
BseBI CCWGG 1 cut(s) 340
BseDI CCNNGG 1 cut(s) 108
BseGI GGATG 3 cut(s) 189, 310, 442
BseLI CCNNNNNNNGG 2 cut(s) 361, 362
BseNI ACTGG 3 cut(s) 6, 356, 446
BseX3I CGGCCG 1 cut(s) 11
BseXI GCAGC 2 cut(s) 374, 396
BsgI GTGCAG 1 cut(s) 380
Bsh1285I CGRYCG 1 cut(s) 14
BshFI GGCC 4 cut(s) 5, 13, 107, 331
BsiEI CGRYCG 1 cut(s) 14
BslI CCNNNNNNNGG 2 cut(s) 361, 362
BsmAI GTCTC 2 cut(s) 21, 30
BsmBI CGTCTC 2 cut(s) 21, 30
BsnI GGCC 4 cut(s) 5, 13, 107, 331
BspACI CCGC 1 cut(s) 180
BspANI GGCC 4 cut(s) 5, 13, 107, 331
BspMI ACCTGC 1 cut(s) 315
BsrI ACTGG 3 cut(s) 6, 356, 446
BssECI CCNNGG 1 cut(s) 108
Bst2UI CCWGG 1 cut(s) 340
Bst4CI ACNGT 1 cut(s) 33
BstC8I GCNNGC 1 cut(s) 156
BstF5I GGATG 3 cut(s) 189, 310, 442
BstMAI GTCTC 2 cut(s) 21, 30
BstMCI CGRYCG 1 cut(s) 14
BstNI CCWGG 1 cut(s) 340
BstSCI CCNGG 1 cut(s) 338
BstSFI CTRYAG 1 cut(s) 405
BstV1I GCAGC 2 cut(s) 374, 396
BstV2I GAAGAC 1 cut(s) 378
BstZI CGGCCG 1 cut(s) 11
BsuRI GGCC 4 cut(s) 5, 13, 107, 331
BtsCI GGATG 3 cut(s) 189, 310, 442
BtsIMutI CAGTG 1 cut(s) 363
BveI ACCTGC 1 cut(s) 315
Cac8I GCNNGC 1 cut(s) 156
CaiI CAGNNNCTG 1 cut(s) 387
CsiI ACCWGGT 1 cut(s) 338
Csp6I GTAC 1 cut(s) 336
CviQI GTAC 1 cut(s) 336
EaeI YGGCCR 2 cut(s) 3, 11
EagI CGGCCG 1 cut(s) 11
EclXI CGGCCG 1 cut(s) 11
Eco52I CGGCCG 1 cut(s) 11
EcoRII CCWGG 1 cut(s) 338
Esp3I CGTCTC 2 cut(s) 21, 30
FaiI YATR 8 cut(s) 177, 210, 267, 278, 293, 314, 346, 348
FauNDI CATATG 1 cut(s) 346
FblI GTMKAC 1 cut(s) 141
Fnu4HI GCNGC 2 cut(s) 385, 388
FokI GGATG 3 cut(s) 176, 317, 429
Fsp4HI GCNGC 2 cut(s) 385, 388
GluI GCNGC 2 cut(s) 385, 388
HaeIII GGCC 4 cut(s) 5, 13, 107, 331
HincII GTYRAC 2 cut(s) 142, 234
HindII GTYRAC 2 cut(s) 142, 234
HinfI GANTC 1 cut(s) 117
HphI GGTGA 2 cut(s) 384, 411
Hpy166II GTNNAC 2 cut(s) 142, 234
Hpy188I TCNGA 1 cut(s) 52
Hpy188III TCNNGA 2 cut(s) 193, 202
Hpy8I GTNNAC 2 cut(s) 142, 234
Hpy99I CGWCG 2 cut(s) 25, 146
HpyAV CCTTC 1 cut(s) 405
HpyCH4III ACNGT 1 cut(s) 33
HpyCH4V TGCA 4 cut(s) 158, 239, 350, 361
Lsp1109I GCAGC 2 cut(s) 374, 396
LweI GCATC 2 cut(s) 167, 451
MabI ACCWGGT 1 cut(s) 338
MboII GAAGA 1 cut(s) 383
MlsI TGGCCA 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 2 cut(s) 69, 75
MnlI CCTC 6 cut(s) 46, 85, 103, 263, 301, 427
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MspA1I CMGCKG 1 cut(s) 387
MspR9I CCNGG 1 cut(s) 340
MvaI CCWGG 1 cut(s) 340
NdeI CATATG 1 cut(s) 346
NmeAIII GCCGAG 1 cut(s) 133
PaqCI CACCTGC 1 cut(s) 315
PcsI WCGNNNNNNNCGW 2 cut(s) 29, 105
PfeI GAWTC 1 cut(s) 117
PkrI GCNGC 2 cut(s) 386, 389
PsiI TTATAA 1 cut(s) 314
Psp6I CCWGG 1 cut(s) 338
PspGI CCWGG 1 cut(s) 338
PstNI CAGNNNCTG 1 cut(s) 387
PvuII CAGCTG 1 cut(s) 387
RsaI GTAC 1 cut(s) 337
RsaNI GTAC 1 cut(s) 336
SalI GTCGAC 1 cut(s) 140
SatI GCNGC 2 cut(s) 385, 388
ScrFI CCNGG 1 cut(s) 340
SetI ASST 9 cut(s) 174, 217, 312, 329, 344, 389, 397, 419, 424
SexAI ACCWGGT 1 cut(s) 338
SfaNI GCATC 2 cut(s) 167, 451
SfcI CTRYAG 1 cut(s) 405
SsiI CCGC 1 cut(s) 180
StyD4I CCNGG 1 cut(s) 338
TaaI ACNGT 1 cut(s) 33
TaqI TCGA 1 cut(s) 141
TfiI GAWTC 1 cut(s) 117
TscAI CASTG 1 cut(s) 363
TseI GCWGC 2 cut(s) 384, 387
TspDTI ATGAA 3 cut(s) 164, 225, 300
TspGWI ACGGA 1 cut(s) 9
TspRI CASTG 1 cut(s) 363
XmiI GTMKAC 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.