Rmu_sc0007574.1_g000007

Protein PHLOEM PROTEIN 2-LIKE

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007574.1
Physical Location & Seq
Reverse (-)
64742 .. 65962
1221 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007574.1_g000007.1.cds

Sequence Viewer

Length: 1221 bp
atggacctggaattggccaaaaagggttttgattatgcccggaaaaggaagaagtggctgtttgtaatggctgctttgggcttctctggttatggtgcttacagggtttattacttgccttcagtgtgtcaaaaaagaaagaggcttttgaagcttttaggggctttagtttctgtagctgaactagtttcagactctgctgagtcgattggagttgtgtctaaagatttgaaggagtttttgcaatctgattctgatgaaattccgaatagcttgaagcaagtttcgaaaatagctaggtcagatgagttttcggggtctgttgttaaggtcacacaagctgtaacattgggtgttttgaggggttatcaagcacaagccaagagtcagggtcatggtgatgatggagtttctgataattcaggctttatggatcaagttatggataagctttttaccaaggcagggtctggttttgcatctgttgttgttggaagctttgctaagaatttggtattagctttctttgcggatgagcagtctggtggaggatcaaattcgaacagttttccaagtaaggatcaatttggcatgaagatgaatgatgttccaagatgggtggatgtggcttgtagcgaaaagtgcagagacctaattgctgattgtatccagttatttgtaagcacagctgttgcggtttatcttgacaagactatggacatcaatacctatgatgatatcttctctgggttaactaaccccaagcatgaagcgaaagtaaaagatatgatgttagcagtctgtaatggtgcagttgaaactcttgttagatcatctcatcaagtgttaacaagttcaaaatccaatgtgaaccatccgaatttgagttcaggttctcaattggccattgatgatgggagaaaagagagtgggtggatcggtcaagtatcctctactttggcagttccaagcaatagaaggtttgttcttgacttgactggacgggttacatctgaaacagttagatcatccttggattttttgttggagagactatttgatgggatgcggaaacgtgttaattctgctcgtgtggaaactgttgacaggggagttgaggttgtgagatatgctgttgcaaagtcttctgttatcgccactatatgtctatctttgtgtttacacataattgatagtccatggctattggcaccggcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

406

Amino Acids

44.21

Weight (kDa)

8.54

Isoelectric Point (pI)

33.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016538)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G49790
fragaria_vesca FvH4_1g18080
malus_domestica MD02G1189000.v1.1
prunus_persica Prupe.6G217700_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0108551
rosa_laevigata RLG00000017678
rosa_multiflora Rmu_sc0007574.1_g000007
rosa_roxburghii Rroxscaffold_2G00135030
rosa_rugosa Rorug02G0154400
rosa_samantha Rh2AG203300 Rh2BG216200 Rh2CG207200 Rh2DG210400
rosa_wichuraiana Rw2G016240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 1210
AciI CCGC 3 cut(s) 530, 695, 1069
AclWI GGATC 4 cut(s) 441, 559, 588, 944
AcoI YGGCCR 2 cut(s) 15, 903
AcsI RAATTY 4 cut(s) 261, 508, 556, 880
AcuI CTGAAG 1 cut(s) 105
AfiI CCNNNNNNNGG 3 cut(s) 13, 45, 465
AflIII ACRYGT 1 cut(s) 1075
AgsI TTSAA 5 cut(s) 151, 232, 277, 818, 858
AhlI ACTAGT 1 cut(s) 184
AjnI CCWGG 1 cut(s) 6
AluBI AGCT 9 cut(s) 154, 179, 273, 296, 341, 451, 498, 521, 689
AluI AGCT 9 cut(s) 154, 179, 273, 296, 341, 451, 498, 521, 689
Alw26I GTCTC 2 cut(s) 642, 1045
AlwI GGATC 4 cut(s) 441, 559, 588, 944
AlwNI CAGNNNCTG 2 cut(s) 197, 470
AoxI GGCC 2 cut(s) 15, 903
ApeKI GCWGC 1 cut(s) 71
ApoI RAATTY 4 cut(s) 261, 508, 556, 880
AspS9I GGNCC 1 cut(s) 4
AsuC2I CCSGG 1 cut(s) 40
AsuHPI GGTGA 1 cut(s) 410
AsuII TTCGAA 2 cut(s) 287, 560
AvaII GGWCC 1 cut(s) 4
BalI TGGCCA 2 cut(s) 17, 905
BanI GGYRCC 1 cut(s) 1210
BauI CACGAG 1 cut(s) 1089
BbsI GAAGAC 1 cut(s) 1137
BbvI GCAGC 1 cut(s) 58
BccI CCATC 5 cut(s) 398, 609, 882, 908, 1055
BciT130I CCWGG 1 cut(s) 8
BciVI GTATCC 2 cut(s) 677, 958
BcnI CCSGG 1 cut(s) 40
BcoDI GTCTC 2 cut(s) 642, 1045
BcuI ACTAGT 1 cut(s) 184
BfaI CTAG 2 cut(s) 185, 297
BfmI CTRYAG 1 cut(s) 174
BfuI GTATCC 2 cut(s) 677, 958
BisI GCNGC 1 cut(s) 72
BlsI GCNGC 1 cut(s) 73
Bme1390I CCNGG 2 cut(s) 8, 40
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 1 cut(s) 1212
BmrFI CCNGG 2 cut(s) 8, 40
BmsI GCATC 2 cut(s) 488, 1056
BpiI GAAGAC 1 cut(s) 1137
Bpu14I TTCGAA 2 cut(s) 287, 560
BpuMI CCSGG 1 cut(s) 40
BsaI GGTCTC 1 cut(s) 642
BsaJI CCNNGG 3 cut(s) 459, 1032, 1199
BsaXI ACNNNNNCTCC 2 cut(s) 1104, 1134
Bsc4I CCNNNNNNNGG 3 cut(s) 13, 45, 465
Bse118I RCCGGY 1 cut(s) 1213
Bse1I ACTGG 2 cut(s) 670, 1003
BseBI CCWGG 1 cut(s) 8
BseDI CCNNGG 3 cut(s) 459, 1032, 1199
BseGI GGATG 5 cut(s) 538, 628, 874, 1028, 1071
BseLI CCNNNNNNNGG 3 cut(s) 13, 45, 465
BseMII CTCAG 1 cut(s) 192
BseNI ACTGG 2 cut(s) 670, 1003
BseXI GCAGC 1 cut(s) 58
BsgI GTGCAG 2 cut(s) 664, 831
BshFI GGCC 2 cut(s) 17, 905
BshNI GGYRCC 1 cut(s) 1210
BsiSI CCGG 2 cut(s) 40, 1214
BslI CCNNNNNNNGG 3 cut(s) 13, 45, 465
BsmAI GTCTC 2 cut(s) 642, 1045
BsnI GGCC 2 cut(s) 17, 905
Bso31I GGTCTC 1 cut(s) 642
Bsp119I TTCGAA 2 cut(s) 287, 560
Bsp143I GATC 6 cut(s) 433, 551, 580, 830, 936, 1025
Bsp19I CCATGG 1 cut(s) 1199
BspACI CCGC 3 cut(s) 530, 695, 1069
BspANI GGCC 2 cut(s) 17, 905
BspCNI CTCAG 1 cut(s) 193
BspLI GGNNCC 1 cut(s) 1212
BspPI GGATC 4 cut(s) 441, 559, 588, 944
BspT104I TTCGAA 2 cut(s) 287, 560
BspT107I GGYRCC 1 cut(s) 1210
BspTNI GGTCTC 1 cut(s) 642
BsrFI RCCGGY 1 cut(s) 1213
BsrI ACTGG 2 cut(s) 670, 1003
BssAI RCCGGY 1 cut(s) 1213
BssECI CCNNGG 3 cut(s) 459, 1032, 1199
BssMI GATC 6 cut(s) 433, 551, 580, 830, 936, 1025
BssSI CACGAG 1 cut(s) 1089
BssT1I CCWWGG 3 cut(s) 459, 1032, 1199
Bst2BI CACGAG 1 cut(s) 1089
Bst2UI CCWGG 1 cut(s) 8
Bst4CI ACNGT 3 cut(s) 566, 1021, 1102
BstBI TTCGAA 2 cut(s) 287, 560
BstDEI CTNAG 3 cut(s) 201, 504, 1218
BstDSI CCRYGG 1 cut(s) 1199
BstF5I GGATG 5 cut(s) 538, 628, 874, 1028, 1071
BstKTI GATC 6 cut(s) 436, 554, 583, 833, 939, 1028
BstMAI GTCTC 2 cut(s) 642, 1045
BstMBI GATC 6 cut(s) 433, 551, 580, 830, 936, 1025
BstMWI GCNNNNNNNGC 3 cut(s) 151, 527, 642
BstNI CCWGG 1 cut(s) 8
BstSCI CCNGG 2 cut(s) 6, 38
BstSFI CTRYAG 1 cut(s) 174
BstV1I GCAGC 1 cut(s) 58
BstV2I GAAGAC 1 cut(s) 1137
BsuI GTATCC 2 cut(s) 677, 958
BsuRI GGCC 2 cut(s) 17, 905
BtgI CCRYGG 1 cut(s) 1199
BtsCI GGATG 5 cut(s) 538, 628, 874, 1028, 1071
BtsIMutI CAGTG 1 cut(s) 129
CaiI CAGNNNCTG 2 cut(s) 197, 470
Cfr10I RCCGGY 1 cut(s) 1213
Cfr13I GGNCC 1 cut(s) 4
CspCI CAANNNNNGTGG 2 cut(s) 600, 635
CviAII CATG 4 cut(s) 395, 592, 767, 1200
DdeI CTNAG 3 cut(s) 201, 504, 1218
DpnI GATC 6 cut(s) 435, 553, 582, 832, 938, 1027
DpnII GATC 6 cut(s) 433, 551, 580, 830, 936, 1025
EaeI YGGCCR 2 cut(s) 15, 903
Eco130I CCWWGG 3 cut(s) 459, 1032, 1199
Eco31I GGTCTC 1 cut(s) 642
Eco32I GATATC 1 cut(s) 739
Eco47I GGWCC 1 cut(s) 4
Eco57I CTGAAG 1 cut(s) 105
EcoRII CCWGG 1 cut(s) 6
EcoRV GATATC 1 cut(s) 739
EcoT14I CCWWGG 3 cut(s) 459, 1032, 1199
ErhI CCWWGG 3 cut(s) 459, 1032, 1199
FaeI CATG 4 cut(s) 398, 595, 770, 1203
FatI CATG 4 cut(s) 394, 591, 766, 1199
Fnu4HI GCNGC 1 cut(s) 72
FokI GGATG 5 cut(s) 545, 635, 861, 1015, 1078
Fsp4HI GCNGC 1 cut(s) 72
FspBI CTAG 2 cut(s) 185, 297
GluI GCNGC 1 cut(s) 72
HaeIII GGCC 2 cut(s) 17, 905
HapII CCGG 2 cut(s) 40, 1214
Hin1II CATG 4 cut(s) 398, 595, 770, 1203
HincII GTYRAC 3 cut(s) 753, 849, 1105
HindII GTYRAC 3 cut(s) 753, 849, 1105
HindIII AAGCTT 3 cut(s) 152, 449, 496
HinfI GANTC 4 cut(s) 194, 203, 251, 385
HpaI GTTAAC 2 cut(s) 753, 849
HpaII CCGG 2 cut(s) 40, 1214
HphI GGTGA 1 cut(s) 410
Hpy166II GTNNAC 5 cut(s) 753, 849, 871, 1105, 1181
Hpy188I TCNGA 8 cut(s) 193, 250, 256, 267, 304, 415, 879, 1015
Hpy188III TCNNGA 2 cut(s) 704, 989
Hpy8I GTNNAC 5 cut(s) 753, 849, 871, 1105, 1181
HpyAV CCTTC 3 cut(s) 129, 226, 972
HpyCH4III ACNGT 3 cut(s) 566, 1021, 1102
HpyCH4IV ACGT 1 cut(s) 1075
HpyCH4V TGCA 5 cut(s) 244, 479, 645, 812, 1139
HpyF10VI GCNNNNNNNGC 3 cut(s) 151, 527, 642
HpyF3I CTNAG 3 cut(s) 201, 504, 1218
HpySE526I ACGT 1 cut(s) 1075
Hsp92II CATG 4 cut(s) 398, 595, 770, 1203
KspAI GTTAAC 2 cut(s) 753, 849
Kzo9I GATC 6 cut(s) 433, 551, 580, 830, 936, 1025
Lsp1109I GCAGC 1 cut(s) 58
LweI GCATC 2 cut(s) 488, 1056
MaeI CTAG 2 cut(s) 185, 297
MaeII ACGT 1 cut(s) 1075
MaeIII GTNAC 3 cut(s) 331, 343, 1006
MalI GATC 6 cut(s) 435, 553, 582, 832, 938, 1027
MboI GATC 6 cut(s) 433, 551, 580, 830, 936, 1025
MboII GAAGA 4 cut(s) 61, 607, 733, 1137
MfeI CAATTG 1 cut(s) 899
MlsI TGGCCA 2 cut(s) 17, 905
MluNI TGGCCA 2 cut(s) 17, 905
MlyI GAGTC 3 cut(s) 188, 212, 394
MmeI TCCRAC 2 cut(s) 472, 1026
MnlI CCTC 5 cut(s) 135, 354, 542, 961, 1111
Mox20I TGGCCA 2 cut(s) 17, 905
MscI TGGCCA 2 cut(s) 17, 905
MseI TTAA 4 cut(s) 327, 752, 848, 1080
MslI CAYNNNNRTG 2 cut(s) 399, 596
Msp20I TGGCCA 2 cut(s) 17, 905
MspA1I CMGCKG 1 cut(s) 689
MspI CCGG 2 cut(s) 40, 1214
MspR9I CCNGG 2 cut(s) 8, 40
MunI CAATTG 1 cut(s) 899
MvaI CCWGG 1 cut(s) 8
MwoI GCNNNNNNNGC 3 cut(s) 151, 527, 642
NciI CCSGG 1 cut(s) 40
NcoI CCATGG 1 cut(s) 1199
NdeII GATC 6 cut(s) 433, 551, 580, 830, 936, 1025
NlaIII CATG 4 cut(s) 398, 595, 770, 1203
NlaIV GGNNCC 1 cut(s) 1212
NmuCI GTSAC 1 cut(s) 331
NspV TTCGAA 2 cut(s) 287, 560
PfeI GAWTC 1 cut(s) 251
PkrI GCNGC 1 cut(s) 73
PleI GAGTC 3 cut(s) 188, 211, 393
PpsI GAGTC 3 cut(s) 188, 211, 393
Psp6I CCWGG 1 cut(s) 6
PspGI CCWGG 1 cut(s) 6
PspN4I GGNNCC 1 cut(s) 1212
PspPI GGNCC 1 cut(s) 4
PstNI CAGNNNCTG 2 cut(s) 197, 470
PvuII CAGCTG 1 cut(s) 689
RseI CAYNNNNRTG 2 cut(s) 399, 596
SaqAI TTAA 4 cut(s) 327, 752, 848, 1080
SatI GCNGC 1 cut(s) 72
Sau3AI GATC 6 cut(s) 433, 551, 580, 830, 936, 1025
Sau96I GGNCC 1 cut(s) 4
SchI GAGTC 3 cut(s) 188, 212, 394
ScrFI CCNGG 2 cut(s) 8, 40
SfaNI GCATC 2 cut(s) 488, 1056
SfcI CTRYAG 1 cut(s) 174
SfuI TTCGAA 2 cut(s) 287, 560
SinI GGWCC 1 cut(s) 4
SmiMI CAYNNNNRTG 2 cut(s) 399, 596
SpeI ACTAGT 1 cut(s) 184
SsiI CCGC 3 cut(s) 530, 695, 1069
SspMI CTAG 2 cut(s) 185, 297
StyD4I CCNGG 2 cut(s) 6, 38
StyI CCWWGG 3 cut(s) 459, 1032, 1199
TaaI ACNGT 3 cut(s) 566, 1021, 1102
TaiI ACGT 1 cut(s) 1078
TaqI TCGA 3 cut(s) 206, 287, 560
TaqII GACCGA 1 cut(s) 929
TfiI GAWTC 1 cut(s) 251
Tru1I TTAA 4 cut(s) 327, 752, 848, 1080
Tru9I TTAA 4 cut(s) 327, 752, 848, 1080
TscAI CASTG 1 cut(s) 129
TseFI GTSAC 1 cut(s) 331
TseI GCWGC 1 cut(s) 71
Tsp45I GTSAC 1 cut(s) 331
TspDTI ATGAA 4 cut(s) 273, 608, 614, 783
TspRI CASTG 1 cut(s) 129
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 4 cut(s) 261, 508, 556, 880
XspI CTAG 2 cut(s) 185, 297
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.