Rmu_sc0007593.1_g000003

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007593.1
Physical Location & Seq
Forward (+)
16686 .. 18247
1562 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007593.1_g000003.1.cds

Sequence Viewer

Length: 999 bp
atgttaactgatgggctcaaaccaactgttgacgtctacacagctcttgttagtgtttatggcaaaagtggcctctttgacaaggcattctctactgttgatgatatgaagtcaatttctgactgcaaaccagatgtatatacatattcaattcttataaattgctgcaccaaattcagtcgctatgatctgattgagcaagttctggctgaaatgtcatatctgggaattggatgtaacacagtcatatacaatactcttattgatggatatggtaaagctgagatgtttgaactgatggaggactcattgacagatatgattgaaagtggcagctgccttcctgatgttttcacattcaattcttttcttggcgcttatgggaaaagtgggcagatagacaagatggagaagtggtatgatgaatttcagctaatgggaataaagccagaccttaagacatttaatgtcctgattaaatcatatgggaaagcaagaatgtatgaaaagatgggatctgttatggagtttatggagaaaaggtatttcaccccaactgttgttacttataacatagtaattgaggtatttgggaaagctggaaatattgtgaagatggaggaatacttcagaaaaatgaagcaccaaggaatgaagcctagctctattacttattgttccctcgttagtgcgtacagcaaagctgggaatataaataaagttgattccattttgaggcaagtagagaattcagatgttatacttgatacagcttttttcaactgtattattagtgcttatggtcgggctggtgatataaataagatgggtgaattatttttgaccatggaagagaaaaaatgtgttcctgatcatatcacctttgctaccatgatccaagcctgcaatgcactaggcatgactgcagctgtcgaagatttaaaaaacaggatgattaccaccaatgacagttcaggcacaaggttgattggattctag

Protein Analysis

332

Amino Acids

37.28

Weight (kDa)

5.2

Isoelectric Point (pI)

32.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 158, 570
AatII GACGTC 1 cut(s) 36
AccI GTMKAC 1 cut(s) 36
AclWI GGATC 2 cut(s) 523, 889
AcsI RAATTY 3 cut(s) 173, 425, 748
AcuI CTGAAG 1 cut(s) 613
AcyI GRCGYC 1 cut(s) 33
AfaI GTAC 1 cut(s) 695
AfiI CCNNNNNNNGG 1 cut(s) 735
AflII CTTAAG 1 cut(s) 455
AgsI TTSAA 5 cut(s) 150, 293, 326, 361, 781
AluBI AGCT 9 cut(s) 44, 281, 336, 433, 599, 663, 704, 773, 929
AluI AGCT 9 cut(s) 44, 281, 336, 433, 599, 663, 704, 773, 929
AlwI GGATC 2 cut(s) 523, 889
AoxI GGCC 1 cut(s) 70
ApeKI GCWGC 4 cut(s) 165, 333, 336, 926
ApoI RAATTY 3 cut(s) 173, 425, 748
AspLEI GCGC 1 cut(s) 377
AsuHPI GGTGA 4 cut(s) 541, 824, 842, 871
BanII GRGCYC 1 cut(s) 18
BbvI GCAGC 4 cut(s) 152, 323, 345, 938
BccI CCATC 7 cut(s) 5, 260, 292, 400, 505, 610, 820
BclI TGATCA 1 cut(s) 871
BfaI CTAG 3 cut(s) 660, 914, 997
BfmI CTRYAG 1 cut(s) 924
BfoI RGCGCY 1 cut(s) 378
BfrI CTTAAG 1 cut(s) 455
BisI GCNGC 4 cut(s) 166, 334, 337, 927
BlsI GCNGC 4 cut(s) 167, 335, 338, 928
BsaHI GRCGYC 1 cut(s) 33
BsaJI CCNNGG 2 cut(s) 646, 846
BsaXI ACNNNNNCTCC 4 cut(s) 401, 431, 527, 557
Bsc4I CCNNNNNNNGG 1 cut(s) 735
Bse3DI GCAATG 1 cut(s) 913
BseDI CCNNGG 2 cut(s) 646, 846
BseGI GGATG 2 cut(s) 239, 957
BseLI CCNNNNNNNGG 1 cut(s) 735
BseMI GCAATG 1 cut(s) 913
BseMII CTCAG 1 cut(s) 273
BseXI GCAGC 4 cut(s) 152, 323, 345, 938
BseYI CCCAGC 1 cut(s) 704
BsgI GTGCAG 1 cut(s) 151
BshFI GGCC 1 cut(s) 72
BslI CCNNNNNNNGG 1 cut(s) 735
BsmI GAATGC 1 cut(s) 86
BsnI GGCC 1 cut(s) 72
Bsp1286I GDGCHC 1 cut(s) 18
Bsp143I GATC 4 cut(s) 187, 515, 871, 894
Bsp19I CCATGG 1 cut(s) 846
BspANI GGCC 1 cut(s) 72
BspCNI CTCAG 1 cut(s) 274
BspMAI CTGCAG 1 cut(s) 928
BspPI GGATC 2 cut(s) 523, 889
BspTI CTTAAG 1 cut(s) 455
BsrDI GCAATG 1 cut(s) 913
BssECI CCNNGG 2 cut(s) 646, 846
BssMI GATC 4 cut(s) 187, 515, 871, 894
BssNI GRCGYC 1 cut(s) 33
BssT1I CCWWGG 2 cut(s) 646, 846
Bst4CI ACNGT 6 cut(s) 28, 97, 244, 559, 785, 971
Bst6I CTCTTC 1 cut(s) 846
BstACI GRCGYC 1 cut(s) 33
BstAFI CTTAAG 1 cut(s) 455
BstC8I GCNNGC 1 cut(s) 904
BstDEI CTNAG 1 cut(s) 282
BstDSI CCRYGG 1 cut(s) 846
BstF5I GGATG 2 cut(s) 239, 957
BstH2I RGCGCY 1 cut(s) 378
BstHHI GCGC 1 cut(s) 377
BstKTI GATC 4 cut(s) 190, 518, 874, 897
BstMBI GATC 4 cut(s) 187, 515, 871, 894
BstMWI GCNNNNNNNGC 2 cut(s) 69, 908
BstSFI CTRYAG 1 cut(s) 924
BstV1I GCAGC 4 cut(s) 152, 323, 345, 938
BstX2I RGATCY 1 cut(s) 515
BstYI RGATCY 1 cut(s) 515
BsuRI GGCC 1 cut(s) 72
BtgI CCRYGG 1 cut(s) 846
BtsCI GGATG 2 cut(s) 239, 957
Cac8I GCNNGC 1 cut(s) 904
CfoI GCGC 1 cut(s) 377
Csp6I GTAC 1 cut(s) 694
CviAII CATG 3 cut(s) 847, 892, 919
CviQI GTAC 1 cut(s) 694
DdeI CTNAG 1 cut(s) 282
DpnI GATC 4 cut(s) 189, 517, 873, 896
DpnII GATC 4 cut(s) 187, 515, 871, 894
DraI TTTAAA 1 cut(s) 942
Eam1104I CTCTTC 1 cut(s) 846
EarI CTCTTC 1 cut(s) 846
Eco130I CCWWGG 2 cut(s) 646, 846
Eco24I GRGCYC 1 cut(s) 18
Eco57I CTGAAG 1 cut(s) 613
EcoRI GAATTC 1 cut(s) 748
EcoT14I CCWWGG 2 cut(s) 646, 846
EcoT38I GRGCYC 1 cut(s) 18
ErhI CCWWGG 2 cut(s) 646, 846
FaeI CATG 3 cut(s) 850, 895, 922
FatI CATG 3 cut(s) 846, 891, 918
FauNDI CATATG 1 cut(s) 484
FbaI TGATCA 1 cut(s) 871
FblI GTMKAC 1 cut(s) 36
Fnu4HI GCNGC 4 cut(s) 166, 334, 337, 927
FokI GGATG 2 cut(s) 246, 964
FriOI GRGCYC 1 cut(s) 18
Fsp4HI GCNGC 4 cut(s) 166, 334, 337, 927
FspBI CTAG 3 cut(s) 660, 914, 997
GlaI GCGC 1 cut(s) 376
GluI GCNGC 4 cut(s) 166, 334, 337, 927
GsaI CCCAGC 1 cut(s) 708
HaeII RGCGCY 1 cut(s) 378
HaeIII GGCC 1 cut(s) 72
HhaI GCGC 1 cut(s) 377
Hin1I GRCGYC 1 cut(s) 33
Hin1II CATG 3 cut(s) 850, 895, 922
Hin6I GCGC 1 cut(s) 375
HinP1I GCGC 1 cut(s) 375
HincII GTYRAC 2 cut(s) 6, 31
HindII GTYRAC 2 cut(s) 6, 31
HinfI GANTC 3 cut(s) 305, 725, 993
HpaI GTTAAC 1 cut(s) 6
HphI GGTGA 4 cut(s) 541, 824, 842, 871
Hpy166II GTNNAC 3 cut(s) 6, 31, 37
Hpy188I TCNGA 4 cut(s) 121, 192, 632, 754
Hpy188III TCNNGA 3 cut(s) 344, 472, 869
Hpy8I GTNNAC 3 cut(s) 6, 31, 37
HpyAV CCTTC 1 cut(s) 350
HpyCH4III ACNGT 6 cut(s) 28, 97, 244, 559, 785, 971
HpyCH4IV ACGT 1 cut(s) 33
HpyCH4V TGCA 5 cut(s) 126, 168, 906, 911, 926
HpyF10VI GCNNNNNNNGC 2 cut(s) 69, 908
HpyF3I CTNAG 1 cut(s) 282
HpySE526I ACGT 1 cut(s) 33
Hsp92I GRCGYC 1 cut(s) 33
Hsp92II CATG 3 cut(s) 850, 895, 922
HspAI GCGC 1 cut(s) 375
Ksp22I TGATCA 1 cut(s) 871
KspAI GTTAAC 1 cut(s) 6
Kzo9I GATC 4 cut(s) 187, 515, 871, 894
Lsp1109I GCAGC 4 cut(s) 152, 323, 345, 938
MaeI CTAG 3 cut(s) 660, 914, 997
MaeII ACGT 1 cut(s) 33
MaeIII GTNAC 2 cut(s) 236, 562
MalI GATC 4 cut(s) 189, 517, 873, 896
MboI GATC 4 cut(s) 187, 515, 871, 894
MboII GAAGA 3 cut(s) 625, 863, 947
MflI RGATCY 1 cut(s) 515
MhlI GDGCHC 1 cut(s) 18
MlyI GAGTC 1 cut(s) 299
MnlI CCTC 6 cut(s) 83, 295, 577, 613, 692, 729
MseI TTAA 5 cut(s) 5, 456, 465, 477, 941
MspA1I CMGCKG 2 cut(s) 336, 929
MspCI CTTAAG 1 cut(s) 455
Mva1269I GAATGC 1 cut(s) 86
MwoI GCNNNNNNNGC 2 cut(s) 69, 908
NcoI CCATGG 1 cut(s) 846
NdeI CATATG 1 cut(s) 484
NdeII GATC 4 cut(s) 187, 515, 871, 894
NlaIII CATG 3 cut(s) 850, 895, 922
PctI GAATGC 1 cut(s) 86
PfeI GAWTC 2 cut(s) 725, 993
PkrI GCNGC 4 cut(s) 167, 335, 338, 928
PleI GAGTC 1 cut(s) 299
PpsI GAGTC 1 cut(s) 299
PsiI TTATAA 2 cut(s) 158, 570
PspFI CCCAGC 1 cut(s) 704
PstI CTGCAG 1 cut(s) 928
PsuI RGATCY 1 cut(s) 515
PvuII CAGCTG 2 cut(s) 336, 929
RsaI GTAC 1 cut(s) 695
RsaNI GTAC 1 cut(s) 694
SaqAI TTAA 5 cut(s) 5, 456, 465, 477, 941
SatI GCNGC 4 cut(s) 166, 334, 337, 927
Sau3AI GATC 4 cut(s) 187, 515, 871, 894
SchI GAGTC 1 cut(s) 299
SduI GDGCHC 1 cut(s) 18
SfcI CTRYAG 1 cut(s) 924
SmlI CTYRAG 1 cut(s) 455
SmoI CTYRAG 1 cut(s) 455
SspI AATATT 1 cut(s) 607
SspMI CTAG 3 cut(s) 660, 914, 997
StyI CCWWGG 2 cut(s) 646, 846
TaaI ACNGT 6 cut(s) 28, 97, 244, 559, 785, 971
TaiI ACGT 1 cut(s) 36
TaqI TCGA 1 cut(s) 933
TfiI GAWTC 2 cut(s) 725, 993
Tru1I TTAA 5 cut(s) 5, 456, 465, 477, 941
Tru9I TTAA 5 cut(s) 5, 456, 465, 477, 941
TseI GCWGC 4 cut(s) 165, 333, 336, 926
TspDTI ATGAA 5 cut(s) 122, 438, 519, 653, 668
Vha464I CTTAAG 1 cut(s) 455
XapI RAATTY 3 cut(s) 173, 425, 748
XmiI GTMKAC 1 cut(s) 36
XspI CTAG 3 cut(s) 660, 914, 997
ZraI GACGTC 1 cut(s) 34
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.