Rmu_sc0008099.1_g000008

Protein of unknown function (DUF642)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008099.1
Physical Location & Seq
Forward (+)
36108 .. 39197
3090 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008099.1_g000008.1.cds

Sequence Viewer

Length: 1104 bp
atgagagggattgccttattgctggcggtgctactctgctccacttgccacctagccacgtccctcatcgatggttatcttgaaaatgggaatttcgagctagccccaaagccctcggacatcaggggcacagaagtgatcggccgctatgccataccgaagtgggaaatttccgggtttgtcgagtacatcaagtcgggccagaagcaaggggacatgttgctggttgtgcctgagggtgcctatgcagttaggcttggaaatgaggcctcaattaagcagaggatcaaagtgaccaagggtttgtactactccataacatttagtgcagccaggacttgtgctcaagaggagcgtttgaacatctctgtggcaccagactctggtgtgctaccaattcagacagtgtatagcagcaatgggtgggattcatatgcttgggcattccaagctgattttccagagattgagcttgttttgcataaccccggagtggaggaagaccctgcttgcggtcctctcatcgattcaattgccatccgaactttgtatcctcctcgagcaaccaacaagaacttgctcaaaaacgctggtttcgaagaaggtccatacttgtttcccaatacatcatggggcgtcctcatcccacccaacattgaagacgatcactctcctctaccaggatggatggtggagtctctcaaagccgtgaagtacatagactcggaccatttctccgtccccgaaggcaaacgggcagtggaactcgtggcaggaaaagaaagcgcaattgcacaagttgtccgcaccatccccggcaagacctacgtgctaacattctccgtcggcgatgctagcaactcgtgcgaagggtccatgattgtggaggcatttgcgggcaggaacacagtgaaagttccttacgagtccaaaggcaaaggcgggttcaagcgagctgtgctcaagttcgtgtcggtttctaaccgcacccggatcatgttcctcagcacattctacaccatgaggagtgatgacttctcttccctgtgtggacctgttcttgatgatgtgaagttgttaagccttcgccgtccaagacaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

367

Amino Acids

40.28

Weight (kDa)

6.47

Isoelectric Point (pI)

40.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0009179)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 239, 373
AccB7I CCANNNNNTGG 1 cut(s) 383
AciI CCGC 7 cut(s) 26, 145, 513, 805, 896, 942, 985
AclWI GGATC 2 cut(s) 293, 1001
AcoI YGGCCR 1 cut(s) 142
AcsI RAATTY 2 cut(s) 91, 168
AcyI GRCGYC 1 cut(s) 636
AfaI GTAC 3 cut(s) 188, 308, 716
AfiI CCNNNNNNNGG 4 cut(s) 383, 493, 512, 680
AflIII ACRYGT 1 cut(s) 216
AgsI TTSAA 5 cut(s) 83, 361, 531, 659, 949
AjiI CACGTC 1 cut(s) 60
AjnI CCWGG 2 cut(s) 332, 679
AjuI GAANNNNNNNTTGG 2 cut(s) 441, 473
AleI CACNNNNGTG 1 cut(s) 134
AloI GAACNNNNNNTCC 2 cut(s) 535, 567
AluBI AGCT 4 cut(s) 100, 452, 472, 956
AluI AGCT 4 cut(s) 100, 452, 472, 956
Alw21I GWGCWC 2 cut(s) 346, 963
Alw26I GTCTC 1 cut(s) 702
AlwI GGATC 2 cut(s) 293, 1001
AlwNI CAGNNNCTG 1 cut(s) 383
Ama87I CYCGRG 1 cut(s) 558
AoxI GGCC 3 cut(s) 142, 199, 267
ApeKI GCWGC 2 cut(s) 329, 414
ApoI RAATTY 2 cut(s) 91, 168
ArsI GACNNNNNNTTYG 2 cut(s) 286, 318
AspLEI GCGC 1 cut(s) 788
AspS9I GGNCC 6 cut(s) 199, 515, 605, 727, 873, 1052
AsuC2I CCSGG 4 cut(s) 175, 489, 816, 991
AsuII TTCGAA 1 cut(s) 597
AsuNHI GCTAGC 2 cut(s) 100, 854
AvaI CYCGRG 1 cut(s) 558
AvaII GGWCC 5 cut(s) 515, 605, 727, 873, 1052
AxyI CCTNAGG 1 cut(s) 234
BaeGI GKGCMC 1 cut(s) 131
BanI GGYRCC 2 cut(s) 239, 373
BauI CACGAG 2 cut(s) 767, 862
BbsI GAAGAC 2 cut(s) 507, 666
Bbv12I GWGCWC 2 cut(s) 346, 963
BbvCI CCTCAGC 1 cut(s) 1004
BbvI GCAGC 2 cut(s) 341, 426
BccI CCATC 5 cut(s) 65, 545, 678, 682, 818
BceAI ACGGC 2 cut(s) 692, 1074
BcgI CGANNNNNNTGC 2 cut(s) 515, 549
BciT130I CCWGG 2 cut(s) 334, 681
BciVI GTATCC 1 cut(s) 561
BcnI CCSGG 4 cut(s) 175, 489, 816, 991
BcoDI GTCTC 1 cut(s) 702
BfaI CTAG 3 cut(s) 53, 101, 855
BfuI GTATCC 1 cut(s) 561
BisI GCNGC 3 cut(s) 145, 330, 415
BlsI GCNGC 3 cut(s) 146, 331, 416
Bme1390I CCNGG 6 cut(s) 175, 334, 489, 681, 816, 991
Bme18I GGWCC 5 cut(s) 515, 605, 727, 873, 1052
BmeT110I CYCGRG 1 cut(s) 558
BmgBI CACGTC 1 cut(s) 60
BmgT120I GGNCC 6 cut(s) 199, 515, 605, 727, 873, 1052
BmiI GGNNCC 3 cut(s) 241, 375, 874
BmrFI CCNGG 6 cut(s) 175, 334, 489, 681, 816, 991
BmsI GCATC 1 cut(s) 841
BmtI GCTAGC 2 cut(s) 104, 858
BpiI GAAGAC 2 cut(s) 507, 666
BplI GAGNNNNNCTC 2 cut(s) 945, 977
Bpu10I CCTNAGC 1 cut(s) 1004
Bpu14I TTCGAA 1 cut(s) 597
BpuEI CTTGAG 2 cut(s) 330, 947
BpuMI CCSGG 4 cut(s) 175, 489, 816, 991
Bsa29I ATCGAT 2 cut(s) 69, 525
BsaAI YACGTR 1 cut(s) 829
BsaBI GATNNNNATC 1 cut(s) 75
BsaHI GRCGYC 1 cut(s) 636
BsaJI CCNNGG 4 cut(s) 114, 297, 487, 814
BsaXI ACNNNNNCTCC 2 cut(s) 719, 749
Bsc4I CCNNNNNNNGG 4 cut(s) 383, 493, 512, 680
Bse21I CCTNAGG 1 cut(s) 234
Bse3DI GCAATG 1 cut(s) 424
Bse8I GATNNNNATC 1 cut(s) 75
BseBI CCWGG 2 cut(s) 334, 681
BseCI ATCGAT 2 cut(s) 69, 525
BseDI CCNNGG 4 cut(s) 114, 297, 487, 814
BseGI GGATG 5 cut(s) 537, 642, 689, 693, 810
BseJI GATNNNNATC 1 cut(s) 75
BseLI CCNNNNNNNGG 4 cut(s) 383, 493, 512, 680
BseMI GCAATG 1 cut(s) 424
BseMII CTCAG 2 cut(s) 225, 1018
BseRI GAGGAG 4 cut(s) 365, 546, 663, 1039
BseSI GKGCMC 1 cut(s) 131
BseX3I CGGCCG 1 cut(s) 142
BseXI GCAGC 2 cut(s) 341, 426
BsgI GTGCAG 1 cut(s) 348
Bsh1285I CGRYCG 1 cut(s) 145
BshFI GGCC 3 cut(s) 144, 201, 269
BshNI GGYRCC 2 cut(s) 239, 373
BshVI ATCGAT 2 cut(s) 69, 525
BsiEI CGRYCG 1 cut(s) 145
BsiHKAI GWGCWC 2 cut(s) 346, 963
BsiHKCI CYCGRG 1 cut(s) 558
BsiSI CCGG 4 cut(s) 174, 489, 816, 991
BslFI GGGAC 3 cut(s) 46, 227, 725
BslI CCNNNNNNNGG 4 cut(s) 383, 493, 512, 680
BsmAI GTCTC 1 cut(s) 702
BsmFI GGGAC 3 cut(s) 46, 227, 725
BsmI GAATGC 1 cut(s) 443
BsnI GGCC 3 cut(s) 144, 201, 269
BsoBI CYCGRG 1 cut(s) 558
Bsp119I TTCGAA 1 cut(s) 597
Bsp1286I GDGCHC 3 cut(s) 131, 346, 963
Bsp143I GATC 4 cut(s) 138, 285, 664, 993
BspACI CCGC 7 cut(s) 26, 145, 513, 805, 896, 942, 985
BspANI GGCC 3 cut(s) 144, 201, 269
BspCNI CTCAG 2 cut(s) 226, 1017
BspDI ATCGAT 2 cut(s) 69, 525
BspLI GGNNCC 3 cut(s) 241, 375, 874
BspOI GCTAGC 2 cut(s) 104, 858
BspPI GGATC 2 cut(s) 293, 1001
BspT104I TTCGAA 1 cut(s) 597
BspT107I GGYRCC 2 cut(s) 239, 373
BsrDI GCAATG 1 cut(s) 424
BssECI CCNNGG 4 cut(s) 114, 297, 487, 814
BssMI GATC 4 cut(s) 138, 285, 664, 993
BssNI GRCGYC 1 cut(s) 636
BssSI CACGAG 2 cut(s) 767, 862
BssT1I CCWWGG 1 cut(s) 297
Bst2BI CACGAG 2 cut(s) 767, 862
Bst2UI CCWGG 2 cut(s) 334, 681
Bst4CI ACNGT 2 cut(s) 406, 910
Bst6I CTCTTC 1 cut(s) 1045
BstACI GRCGYC 1 cut(s) 636
BstAPI GCANNNNNTGC 1 cut(s) 864
BstBAI YACGTR 1 cut(s) 829
BstBI TTCGAA 1 cut(s) 597
BstC8I GCNNGC 6 cut(s) 24, 102, 511, 856, 898, 954
BstDEI CTNAG 2 cut(s) 234, 1004
BstENI CCTNNNNNAGG 1 cut(s) 678
BstF5I GGATG 5 cut(s) 537, 642, 689, 693, 810
BstHHI GCGC 1 cut(s) 788
BstKTI GATC 4 cut(s) 141, 288, 667, 996
BstMAI GTCTC 1 cut(s) 702
BstMBI GATC 4 cut(s) 138, 285, 664, 993
BstMCI CGRYCG 1 cut(s) 145
BstMWI GCNNNNNNNGC 8 cut(s) 28, 45, 229, 449, 478, 855, 864, 958
BstNI CCWGG 2 cut(s) 334, 681
BstNSI RCATGY 1 cut(s) 220
BstSCI CCNGG 6 cut(s) 173, 332, 487, 679, 814, 989
BstSLI GKGCMC 1 cut(s) 131
BstV1I GCAGC 2 cut(s) 341, 426
BstV2I GAAGAC 2 cut(s) 507, 666
BstXI CCANNNNNNTGG 1 cut(s) 883
BstZI CGGCCG 1 cut(s) 142
Bsu15I ATCGAT 2 cut(s) 69, 525
Bsu36I CCTNAGG 1 cut(s) 234
BsuI GTATCC 1 cut(s) 561
BsuRI GGCC 3 cut(s) 144, 201, 269
BsuTUI ATCGAT 2 cut(s) 69, 525
BtgZI GCGATG 1 cut(s) 864
BtrI CACGTC 1 cut(s) 60
BtsCI GGATG 5 cut(s) 537, 642, 689, 693, 810
BtsI GCAGTG 1 cut(s) 765
BtsIMutI CAGTG 3 cut(s) 411, 765, 915
Cac8I GCNNGC 6 cut(s) 24, 102, 511, 856, 898, 954
CaiI CAGNNNCTG 1 cut(s) 383
CfoI GCGC 1 cut(s) 788
Cfr13I GGNCC 6 cut(s) 199, 515, 605, 727, 873, 1052
ClaI ATCGAT 2 cut(s) 69, 525
CseI GACGC 1 cut(s) 625
Csp6I GTAC 3 cut(s) 187, 307, 715
CviAII CATG 5 cut(s) 217, 630, 877, 997, 1021
CviQI GTAC 3 cut(s) 187, 307, 715
DdeI CTNAG 2 cut(s) 234, 1004
DpnI GATC 4 cut(s) 140, 287, 666, 995
DpnII GATC 4 cut(s) 138, 285, 664, 993
EaeI YGGCCR 1 cut(s) 142
EagI CGGCCG 1 cut(s) 142
Eam1104I CTCTTC 1 cut(s) 1045
EarI CTCTTC 1 cut(s) 1045
EclXI CGGCCG 1 cut(s) 142
Eco130I CCWWGG 1 cut(s) 297
Eco147I AGGCCT 1 cut(s) 269
Eco47I GGWCC 5 cut(s) 515, 605, 727, 873, 1052
Eco52I CGGCCG 1 cut(s) 142
Eco81I CCTNAGG 1 cut(s) 234
Eco88I CYCGRG 1 cut(s) 558
EcoNI CCTNNNNNAGG 1 cut(s) 678
EcoRII CCWGG 2 cut(s) 332, 679
EcoT14I CCWWGG 1 cut(s) 297
ErhI CCWWGG 1 cut(s) 297
FaeI CATG 5 cut(s) 220, 633, 880, 1000, 1024
FaqI GGGAC 3 cut(s) 46, 227, 725
FatI CATG 5 cut(s) 216, 629, 876, 996, 1020
FauI CCCGC 2 cut(s) 889, 935
FauNDI CATATG 1 cut(s) 433
Fnu4HI GCNGC 3 cut(s) 145, 330, 415
FokI GGATG 5 cut(s) 524, 629, 696, 700, 797
Fsp4HI GCNGC 3 cut(s) 145, 330, 415
FspBI CTAG 3 cut(s) 53, 101, 855
GlaI GCGC 1 cut(s) 787
GluI GCNGC 3 cut(s) 145, 330, 415
HaeIII GGCC 3 cut(s) 144, 201, 269
HapII CCGG 4 cut(s) 174, 489, 816, 991
HgaI GACGC 1 cut(s) 625
HhaI GCGC 1 cut(s) 788
Hin1I GRCGYC 1 cut(s) 636
Hin1II CATG 5 cut(s) 220, 633, 880, 1000, 1024
Hin6I GCGC 1 cut(s) 786
HinP1I GCGC 1 cut(s) 786
HinfI GANTC 6 cut(s) 380, 428, 527, 695, 722, 926
HpaII CCGG 4 cut(s) 174, 489, 816, 991
Hpy166II GTNNAC 1 cut(s) 1052
Hpy188I TCNGA 4 cut(s) 118, 402, 542, 727
Hpy188III TCNNGA 4 cut(s) 80, 347, 461, 1061
Hpy8I GTNNAC 1 cut(s) 1052
Hpy99I CGWCG 1 cut(s) 848
HpyAV CCTTC 4 cut(s) 596, 740, 863, 1094
HpyCH4III ACNGT 2 cut(s) 406, 910
HpyCH4IV ACGT 2 cut(s) 59, 828
HpyCH4V TGCA 4 cut(s) 248, 329, 481, 794
HpyF10VI GCNNNNNNNGC 8 cut(s) 28, 45, 229, 449, 478, 855, 864, 958
HpyF3I CTNAG 2 cut(s) 234, 1004
HpySE526I ACGT 2 cut(s) 59, 828
Hsp92I GRCGYC 1 cut(s) 636
Hsp92II CATG 5 cut(s) 220, 633, 880, 1000, 1024
HspAI GCGC 1 cut(s) 786
Kzo9I GATC 4 cut(s) 138, 285, 664, 993
LmnI GCTCC 2 cut(s) 44, 352
Lsp1109I GCAGC 2 cut(s) 341, 426
LweI GCATC 1 cut(s) 841
MaeI CTAG 3 cut(s) 53, 101, 855
MaeII ACGT 2 cut(s) 59, 828
MaeIII GTNAC 1 cut(s) 292
MalI GATC 4 cut(s) 140, 287, 666, 995
MboI GATC 4 cut(s) 138, 285, 664, 993
MboII GAAGA 4 cut(s) 512, 611, 671, 1032
MfeI CAATTG 2 cut(s) 531, 789
MhlI GDGCHC 3 cut(s) 131, 346, 963
MluCI AATT 6 cut(s) 91, 168, 273, 396, 531, 789
MlyI GAGTC 4 cut(s) 374, 704, 716, 935
MseI TTAA 2 cut(s) 276, 1079
MslI CAYNNNNRTG 3 cut(s) 134, 368, 881
MspI CCGG 4 cut(s) 174, 489, 816, 991
MspR9I CCNGG 6 cut(s) 175, 334, 489, 681, 816, 991
MunI CAATTG 2 cut(s) 531, 789
Mva1269I GAATGC 1 cut(s) 443
MvaI CCWGG 2 cut(s) 334, 681
MwoI GCNNNNNNNGC 8 cut(s) 28, 45, 229, 449, 478, 855, 864, 958
NciI CCSGG 4 cut(s) 175, 489, 816, 991
NdeI CATATG 1 cut(s) 433
NdeII GATC 4 cut(s) 138, 285, 664, 993
NheI GCTAGC 2 cut(s) 100, 854
NlaIII CATG 5 cut(s) 220, 633, 880, 1000, 1024
NlaIV GGNNCC 3 cut(s) 241, 375, 874
NmuCI GTSAC 1 cut(s) 292
NspI RCATGY 1 cut(s) 220
NspV TTCGAA 1 cut(s) 597
OliI CACNNNNGTG 1 cut(s) 134
PaeR7I CTCGAG 1 cut(s) 558
PceI AGGCCT 1 cut(s) 269
PciI ACATGT 1 cut(s) 216
PcsI WCGNNNNNNNCGW 1 cut(s) 594
PctI GAATGC 1 cut(s) 443
PfeI GAWTC 2 cut(s) 428, 527
PflMI CCANNNNNTGG 1 cut(s) 383
PkrI GCNGC 3 cut(s) 146, 331, 416
PleI GAGTC 4 cut(s) 374, 703, 716, 934
PpsI GAGTC 4 cut(s) 374, 703, 716, 934
Ppu21I YACGTR 1 cut(s) 829
PscI ACATGT 1 cut(s) 216
Psp6I CCWGG 2 cut(s) 332, 679
PspGI CCWGG 2 cut(s) 332, 679
PspN4I GGNNCC 3 cut(s) 241, 375, 874
PspPI GGNCC 6 cut(s) 199, 515, 605, 727, 873, 1052
PspXI VCTCGAGB 1 cut(s) 558
PstNI CAGNNNCTG 1 cut(s) 383
RsaI GTAC 3 cut(s) 188, 308, 716
RsaNI GTAC 3 cut(s) 187, 307, 715
RseI CAYNNNNRTG 3 cut(s) 134, 368, 881
SaqAI TTAA 2 cut(s) 276, 1079
SatI GCNGC 3 cut(s) 145, 330, 415
Sau3AI GATC 4 cut(s) 138, 285, 664, 993
Sau96I GGNCC 6 cut(s) 199, 515, 605, 727, 873, 1052
SchI GAGTC 4 cut(s) 374, 704, 716, 935
ScrFI CCNGG 6 cut(s) 175, 334, 489, 681, 816, 991
SduI GDGCHC 3 cut(s) 131, 346, 963
SfaNI GCATC 1 cut(s) 841
Sfr274I CTCGAG 1 cut(s) 558
SfuI TTCGAA 1 cut(s) 597
SinI GGWCC 5 cut(s) 515, 605, 727, 873, 1052
SlaI CTCGAG 1 cut(s) 558
SmiMI CAYNNNNRTG 3 cut(s) 134, 368, 881
SmlI CTYRAG 3 cut(s) 345, 558, 962
SmoI CTYRAG 3 cut(s) 345, 558, 962
Sse9I AATT 6 cut(s) 91, 168, 273, 396, 531, 789
SseBI AGGCCT 1 cut(s) 269
SsiI CCGC 7 cut(s) 26, 145, 513, 805, 896, 942, 985
SspMI CTAG 3 cut(s) 53, 101, 855
StuI AGGCCT 1 cut(s) 269
StyD4I CCNGG 6 cut(s) 173, 332, 487, 679, 814, 989
StyI CCWWGG 1 cut(s) 297
TaaI ACNGT 2 cut(s) 406, 910
TaiI ACGT 2 cut(s) 62, 831
TaqI TCGA 6 cut(s) 69, 96, 183, 525, 559, 597
TasI AATT 6 cut(s) 91, 168, 273, 396, 531, 789
TatI WGTACW 3 cut(s) 186, 306, 714
TauI GCSGC 1 cut(s) 147
TfiI GAWTC 2 cut(s) 428, 527
Tru1I TTAA 2 cut(s) 276, 1079
Tru9I TTAA 2 cut(s) 276, 1079
TscAI CASTG 3 cut(s) 411, 765, 915
TseFI GTSAC 1 cut(s) 292
TseI GCWGC 2 cut(s) 329, 414
Tsp45I GTSAC 1 cut(s) 292
TspDTI ATGAA 1 cut(s) 420
TspGWI ACGGA 2 cut(s) 727, 832
TspRI CASTG 3 cut(s) 411, 765, 915
Van91I CCANNNNNTGG 1 cut(s) 383
VpaK11BI GGWCC 5 cut(s) 515, 605, 727, 873, 1052
XagI CCTNNNNNAGG 1 cut(s) 678
XapI RAATTY 2 cut(s) 91, 168
XceI RCATGY 1 cut(s) 220
XhoI CTCGAG 1 cut(s) 558
XspI CTAG 3 cut(s) 53, 101, 855
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.