Rmu_sc0008176.1_g000006

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008176.1
Physical Location & Seq
Reverse (-)
32685 .. 35207
2523 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008176.1_g000006.1.cds

Sequence Viewer

Length: 726 bp
atgacagccattgttcaaatctccatcaattccttagctttcaggttgagcagtttgcaaaatgacacatacaacaaacccatcaagtattgctctctatccagaacgaaaattgcttctttgaagctcaacaggttaacgttgagggctttttgggagagtgggcctatcagtggagacgggattttggtgaaagatgaggggtggaataggaagaagaaaagagaggttgtggtgaggtttaatcaggggtttgggtttaatggtggaggtggtggtgggaaagatgatggaactactgctagggtgttgggtaatatagctgtggctattgggttgacttatctttcatttactgggcagcttggttggcttctggatgcaattgtttccatttggctcatagcatttcttgtgccaattgttggtttgggtgcttttctgtggtgggcaggacgggatatggttcaagacagttgcccaaactgcggaaatgattttcagattttcaaatctactttaaatgatgatatgcagcagtgcccgtactgtagtcaacctttctctgtggtggacaacaagtttgtaatggacccagtgaatttctctaatcgatctacaacatttggccaggcatttaatgactacacacgttcaaaaacagggaagaaggattcttctacagcggttgttgatgttgaagcagaagtaatggatgcagactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

241

Amino Acids

26.5

Weight (kDa)

8.24

Isoelectric Point (pI)

28.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 425
AciI CCGC 2 cut(s) 489, 686
AclI AACGTT 1 cut(s) 140
AcoI YGGCCR 1 cut(s) 628
AcsI RAATTY 1 cut(s) 601
AfaI GTAC 1 cut(s) 548
AfiI CCNNNNNNNGG 3 cut(s) 173, 425, 488
AflIII ACRYGT 1 cut(s) 650
AgsI TTSAA 6 cut(s) 17, 124, 470, 511, 657, 701
AjnI CCWGG 1 cut(s) 630
AluBI AGCT 4 cut(s) 38, 127, 323, 364
AluI AGCT 4 cut(s) 38, 127, 323, 364
Alw26I GTCTC 1 cut(s) 171
AoxI GGCC 2 cut(s) 164, 628
ApeKI GCWGC 2 cut(s) 361, 535
ApoI RAATTY 1 cut(s) 601
ArsI GACNNNNNNTTYG 2 cut(s) 566, 598
AspS9I GGNCC 2 cut(s) 164, 592
AsuHPI GGTGA 2 cut(s) 202, 247
AvaII GGWCC 1 cut(s) 592
BaeGI GKGCMC 1 cut(s) 545
BalI TGGCCA 1 cut(s) 630
BbvI GCAGC 2 cut(s) 373, 547
BccI CCATC 3 cut(s) 32, 89, 284
BciT130I CCWGG 1 cut(s) 632
BcoDI GTCTC 1 cut(s) 171
BfaI CTAG 1 cut(s) 303
BfmI CTRYAG 2 cut(s) 550, 681
BisI GCNGC 2 cut(s) 362, 536
BlsI GCNGC 2 cut(s) 363, 537
Bme1390I CCNGG 1 cut(s) 632
Bme18I GGWCC 1 cut(s) 592
BmgT120I GGNCC 2 cut(s) 164, 592
BmiI GGNNCC 1 cut(s) 594
BmrFI CCNGG 1 cut(s) 632
BmrI ACTGGG 2 cut(s) 366, 590
BmsI GCATC 2 cut(s) 370, 706
BmuI ACTGGG 2 cut(s) 366, 590
Bpu10I CCTNAGC 1 cut(s) 34
Bsa29I ATCGAT 1 cut(s) 613
Bsc4I CCNNNNNNNGG 3 cut(s) 173, 425, 488
Bse1I ACTGG 2 cut(s) 361, 596
BseBI CCWGG 1 cut(s) 632
BseCI ATCGAT 1 cut(s) 613
BseGI GGATG 2 cut(s) 385, 721
BseLI CCNNNNNNNGG 3 cut(s) 173, 425, 488
BseNI ACTGG 2 cut(s) 361, 596
BseSI GKGCMC 1 cut(s) 545
BseXI GCAGC 2 cut(s) 373, 547
BshFI GGCC 2 cut(s) 166, 630
BshVI ATCGAT 1 cut(s) 613
BslI CCNNNNNNNGG 3 cut(s) 173, 425, 488
BsmAI GTCTC 1 cut(s) 171
BsmBI CGTCTC 1 cut(s) 171
BsnI GGCC 2 cut(s) 166, 630
Bsp1286I GDGCHC 1 cut(s) 545
Bsp143I GATC 1 cut(s) 614
BspACI CCGC 2 cut(s) 489, 686
BspANI GGCC 2 cut(s) 166, 630
BspDI ATCGAT 1 cut(s) 613
BspLI GGNNCC 1 cut(s) 594
BsrI ACTGG 2 cut(s) 361, 596
BssMI GATC 1 cut(s) 614
Bst2UI CCWGG 1 cut(s) 632
Bst4CI ACNGT 2 cut(s) 476, 551
BstDEI CTNAG 1 cut(s) 34
BstF5I GGATG 2 cut(s) 385, 721
BstKTI GATC 1 cut(s) 617
BstMAI GTCTC 1 cut(s) 171
BstMBI GATC 1 cut(s) 614
BstMWI GCNNNNNNNGC 2 cut(s) 370, 486
BstNI CCWGG 1 cut(s) 632
BstSCI CCNGG 1 cut(s) 630
BstSFI CTRYAG 2 cut(s) 550, 681
BstSLI GKGCMC 1 cut(s) 545
BstV1I GCAGC 2 cut(s) 373, 547
Bsu15I ATCGAT 1 cut(s) 613
BsuRI GGCC 2 cut(s) 166, 630
BsuTUI ATCGAT 1 cut(s) 613
BtsCI GGATG 2 cut(s) 385, 721
BtsI GCAGTG 1 cut(s) 545
BtsIMutI CAGTG 3 cut(s) 178, 545, 603
Cfr13I GGNCC 2 cut(s) 164, 592
ClaI ATCGAT 1 cut(s) 613
Csp6I GTAC 1 cut(s) 547
CviQI GTAC 1 cut(s) 547
DdeI CTNAG 1 cut(s) 34
DpnI GATC 1 cut(s) 616
DpnII GATC 1 cut(s) 614
DraI TTTAAA 1 cut(s) 522
EaeI YGGCCR 1 cut(s) 628
Eco47I GGWCC 1 cut(s) 592
EcoRII CCWGG 1 cut(s) 630
Esp3I CGTCTC 1 cut(s) 171
FaiI YATR 5 cut(s) 70, 320, 404, 464, 533
Fnu4HI GCNGC 2 cut(s) 362, 536
FokI GGATG 1 cut(s) 392
Fsp4HI GCNGC 2 cut(s) 362, 536
FspBI CTAG 1 cut(s) 303
GluI GCNGC 2 cut(s) 362, 536
HaeIII GGCC 2 cut(s) 166, 630
HincII GTYRAC 3 cut(s) 138, 339, 557
HindII GTYRAC 3 cut(s) 138, 339, 557
HinfI GANTC 1 cut(s) 674
HpaI GTTAAC 1 cut(s) 138
HphI GGTGA 2 cut(s) 202, 247
Hpy166II GTNNAC 4 cut(s) 138, 339, 557, 574
Hpy188I TCNGA 1 cut(s) 504
Hpy188III TCNNGA 3 cut(s) 102, 377, 470
Hpy8I GTNNAC 4 cut(s) 138, 339, 557, 574
HpyAV CCTTC 1 cut(s) 664
HpyCH4III ACNGT 2 cut(s) 476, 551
HpyCH4IV ACGT 2 cut(s) 140, 652
HpyCH4V TGCA 4 cut(s) 58, 383, 535, 719
HpyF10VI GCNNNNNNNGC 2 cut(s) 370, 486
HpyF3I CTNAG 1 cut(s) 34
HpySE526I ACGT 2 cut(s) 140, 652
KspAI GTTAAC 1 cut(s) 138
Kzo9I GATC 1 cut(s) 614
Lsp1109I GCAGC 2 cut(s) 373, 547
LweI GCATC 2 cut(s) 370, 706
MaeI CTAG 1 cut(s) 303
MaeII ACGT 2 cut(s) 140, 652
MalI GATC 1 cut(s) 616
MboI GATC 1 cut(s) 614
MboII GAAGA 4 cut(s) 226, 229, 669, 679
MfeI CAATTG 2 cut(s) 384, 420
MhlI GDGCHC 1 cut(s) 545
MlsI TGGCCA 1 cut(s) 630
MluCI AATT 5 cut(s) 28, 111, 384, 420, 601
MluNI TGGCCA 1 cut(s) 630
MnlI CCTC 5 cut(s) 138, 193, 220, 231, 263
Mox20I TGGCCA 1 cut(s) 630
MscI TGGCCA 1 cut(s) 630
MseI TTAA 5 cut(s) 137, 243, 261, 521, 639
Msp20I TGGCCA 1 cut(s) 630
MspA1I CMGCKG 1 cut(s) 686
MspR9I CCNGG 1 cut(s) 632
MunI CAATTG 2 cut(s) 384, 420
MvaI CCWGG 1 cut(s) 632
MwoI GCNNNNNNNGC 2 cut(s) 370, 486
NdeII GATC 1 cut(s) 614
NlaIV GGNNCC 1 cut(s) 594
PfeI GAWTC 1 cut(s) 674
PflMI CCANNNNNTGG 1 cut(s) 425
PkrI GCNGC 2 cut(s) 363, 537
Psp1406I AACGTT 1 cut(s) 140
Psp6I CCWGG 1 cut(s) 630
PspGI CCWGG 1 cut(s) 630
PspN4I GGNNCC 1 cut(s) 594
PspPI GGNCC 2 cut(s) 164, 592
RsaI GTAC 1 cut(s) 548
RsaNI GTAC 1 cut(s) 547
SaqAI TTAA 5 cut(s) 137, 243, 261, 521, 639
SatI GCNGC 2 cut(s) 362, 536
Sau3AI GATC 1 cut(s) 614
Sau96I GGNCC 2 cut(s) 164, 592
ScrFI CCNGG 1 cut(s) 632
SduI GDGCHC 1 cut(s) 545
SfaNI GCATC 2 cut(s) 370, 706
SfcI CTRYAG 2 cut(s) 550, 681
SinI GGWCC 1 cut(s) 592
Sse9I AATT 5 cut(s) 28, 111, 384, 420, 601
SsiI CCGC 2 cut(s) 489, 686
SspMI CTAG 1 cut(s) 303
StyD4I CCNGG 1 cut(s) 630
TaaI ACNGT 2 cut(s) 476, 551
TaiI ACGT 2 cut(s) 143, 655
TaqI TCGA 1 cut(s) 613
TasI AATT 5 cut(s) 28, 111, 384, 420, 601
TfiI GAWTC 1 cut(s) 674
Tru1I TTAA 5 cut(s) 137, 243, 261, 521, 639
Tru9I TTAA 5 cut(s) 137, 243, 261, 521, 639
TscAI CASTG 3 cut(s) 178, 545, 603
TseI GCWGC 2 cut(s) 361, 535
TspDTI ATGAA 1 cut(s) 339
TspRI CASTG 3 cut(s) 178, 545, 603
Van91I CCANNNNNTGG 1 cut(s) 425
VpaK11BI GGWCC 1 cut(s) 592
XapI RAATTY 1 cut(s) 601
XspI CTAG 1 cut(s) 303
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.