Rmu_sc0008551.1_g000001

Protein of unknown function (DUF1336)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008551.1
Physical Location & Seq
Reverse (-)
2 .. 1113
1112 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008551.1_g000001.1.cds

Sequence Viewer

Length: 429 bp
gatgaaatctcctcctctgtggatgaaagttcttccaaggaggaaggtatattggataattgtgggattcttccaagcaactgtctgccttgtcttgtttcaactgaatcctcggatggaaagagacgctcactaagttatagtccaccaagtgcaaggaagagggctgccataaaacttcccttcaaatggaaagaacctgccaatgcaagtttattttcatcaaagatgattctagaaagaccaatagcaggttcccaagttcctttttgccctatagaaaagaacatgttcgattcttggtcacaaattgagccacgtactttcaaaattcggggagtgaactatcttagggacaagaagaaggaatttgctgcgaactatgctgcatattatccatttggtcttgacgtatttttatctcagcga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

143

Amino Acids

16.08

Weight (kDa)

8.9

Isoelectric Point (pI)

77.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 208, 242
AcsI RAATTY 2 cut(s) 330, 368
AdeI CACNNNGTG 1 cut(s) 152
AfaI GTAC 1 cut(s) 322
AfiI CCNNNNNNNGG 2 cut(s) 189, 251
AflIII ACRYGT 1 cut(s) 288
AgsI TTSAA 3 cut(s) 102, 187, 328
AjuI GAANNNNNNNTTGG 2 cut(s) 238, 270
Alw26I GTCTC 1 cut(s) 118
ApeKI GCWGC 3 cut(s) 167, 374, 386
ApoI RAATTY 2 cut(s) 330, 368
Asp700I GAANNNNTTC 1 cut(s) 290
BbvI GCAGC 3 cut(s) 154, 361, 373
BccI CCATC 1 cut(s) 110
BcoDI GTCTC 1 cut(s) 118
BfaI CTAG 1 cut(s) 236
BfmI CTRYAG 1 cut(s) 276
BfuAI ACCTGC 2 cut(s) 208, 242
BisI GCNGC 3 cut(s) 168, 375, 387
BlsI GCNGC 3 cut(s) 169, 376, 388
BmiI GGNNCC 1 cut(s) 256
BsaAI YACGTR 1 cut(s) 320
BsaJI CCNNGG 2 cut(s) 36, 111
Bsc4I CCNNNNNNNGG 2 cut(s) 189, 251
BseDI CCNNGG 2 cut(s) 36, 111
BseGI GGATG 2 cut(s) 28, 121
BseLI CCNNNNNNNGG 2 cut(s) 189, 251
BseRI GAGGAG 1 cut(s) 4
BseXI GCAGC 3 cut(s) 154, 361, 373
BslFI GGGAC 1 cut(s) 368
BslI CCNNNNNNNGG 2 cut(s) 189, 251
BsmAI GTCTC 1 cut(s) 118
BsmBI CGTCTC 1 cut(s) 118
BsmFI GGGAC 1 cut(s) 368
BspLI GGNNCC 1 cut(s) 256
BspMI ACCTGC 2 cut(s) 208, 242
BssECI CCNNGG 2 cut(s) 36, 111
BssT1I CCWWGG 1 cut(s) 36
Bst4CI ACNGT 1 cut(s) 83
Bst6I CTCTTC 1 cut(s) 155
BstBAI YACGTR 1 cut(s) 320
BstDEI CTNAG 3 cut(s) 134, 350, 423
BstF5I GGATG 2 cut(s) 28, 121
BstMAI GTCTC 1 cut(s) 118
BstMWI GCNNNNNNNGC 1 cut(s) 383
BstNSI RCATGY 1 cut(s) 292
BstSFI CTRYAG 1 cut(s) 276
BstV1I GCAGC 3 cut(s) 154, 361, 373
BtsCI GGATG 2 cut(s) 28, 121
BveI ACCTGC 2 cut(s) 208, 242
CseI GACGC 1 cut(s) 135
Csp6I GTAC 1 cut(s) 321
CviAII CATG 1 cut(s) 289
CviJI RGCY 2 cut(s) 167, 316
CviKI_1 RGCY 2 cut(s) 167, 316
CviQI GTAC 1 cut(s) 321
DdeI CTNAG 3 cut(s) 134, 350, 423
DraIII CACNNNGTG 1 cut(s) 152
Eam1104I CTCTTC 1 cut(s) 155
EarI CTCTTC 1 cut(s) 155
Eco130I CCWWGG 1 cut(s) 36
EcoT14I CCWWGG 1 cut(s) 36
ErhI CCWWGG 1 cut(s) 36
Esp3I CGTCTC 1 cut(s) 118
FaeI CATG 1 cut(s) 292
FaiI YATR 7 cut(s) 50, 141, 173, 278, 290, 384, 391
FaqI GGGAC 1 cut(s) 368
FatI CATG 1 cut(s) 288
Fnu4HI GCNGC 3 cut(s) 168, 375, 387
FokI GGATG 2 cut(s) 35, 128
Fsp4HI GCNGC 3 cut(s) 168, 375, 387
FspBI CTAG 1 cut(s) 236
GluI GCNGC 3 cut(s) 168, 375, 387
HgaI GACGC 1 cut(s) 135
Hin1II CATG 1 cut(s) 292
HinfI GANTC 4 cut(s) 67, 107, 232, 296
Hpy166II GTNNAC 2 cut(s) 146, 343
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 2 cut(s) 236, 407
Hpy8I GTNNAC 2 cut(s) 146, 343
HpyAV CCTTC 3 cut(s) 38, 193, 358
HpyCH4III ACNGT 1 cut(s) 83
HpyCH4IV ACGT 2 cut(s) 319, 411
HpyCH4V TGCA 3 cut(s) 155, 209, 389
HpyF10VI GCNNNNNNNGC 1 cut(s) 383
HpyF3I CTNAG 3 cut(s) 134, 350, 423
HpySE526I ACGT 2 cut(s) 319, 411
Hsp92II CATG 1 cut(s) 292
LpnPI CCDG 2 cut(s) 213, 237
Lsp1109I GCAGC 3 cut(s) 154, 361, 373
MaeI CTAG 1 cut(s) 236
MaeII ACGT 2 cut(s) 319, 411
MaeIII GTNAC 1 cut(s) 303
MboII GAAGA 4 cut(s) 24, 62, 172, 373
MluCI AATT 4 cut(s) 58, 309, 330, 368
MnlI CCTC 5 cut(s) 22, 25, 34, 121, 156
MroXI GAANNNNTTC 1 cut(s) 290
MwoI GCNNNNNNNGC 1 cut(s) 383
NlaIII CATG 1 cut(s) 292
NlaIV GGNNCC 1 cut(s) 256
NmuCI GTSAC 1 cut(s) 303
NspI RCATGY 1 cut(s) 292
PciI ACATGT 1 cut(s) 288
PdmI GAANNNNTTC 1 cut(s) 290
PfeI GAWTC 4 cut(s) 67, 107, 232, 296
PkrI GCNGC 3 cut(s) 169, 376, 388
Ppu21I YACGTR 1 cut(s) 320
PscI ACATGT 1 cut(s) 288
PspN4I GGNNCC 1 cut(s) 256
RsaI GTAC 1 cut(s) 322
RsaNI GTAC 1 cut(s) 321
SatI GCNGC 3 cut(s) 168, 375, 387
SetI ASST 5 cut(s) 49, 202, 256, 322, 414
SfcI CTRYAG 1 cut(s) 276
Sse9I AATT 4 cut(s) 58, 309, 330, 368
SspMI CTAG 1 cut(s) 236
StyI CCWWGG 1 cut(s) 36
TaaI ACNGT 1 cut(s) 83
TaiI ACGT 2 cut(s) 322, 414
TaqI TCGA 1 cut(s) 294
TasI AATT 4 cut(s) 58, 309, 330, 368
TfiI GAWTC 4 cut(s) 67, 107, 232, 296
TseFI GTSAC 1 cut(s) 303
TseI GCWGC 3 cut(s) 167, 374, 386
Tsp45I GTSAC 1 cut(s) 303
TspDTI ATGAA 3 cut(s) 18, 39, 210
XapI RAATTY 2 cut(s) 330, 368
XbaI TCTAGA 1 cut(s) 235
XceI RCATGY 1 cut(s) 292
XmnI GAANNNNTTC 1 cut(s) 290
XspI CTAG 1 cut(s) 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.