Rmu_sc0008612.1_g000007

Uncharacterized integral membrane protein (DUF2301)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008612.1
OG0013259
Physical Location & Seq
Reverse (-)
21775 .. 23156
1382 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008612.1_g000007.1.cds

Sequence Viewer

Length: 843 bp
atggcttcacatatgttgtgtgcatccattgtcactcctactcctgcatcaaacctcaccaagcttccaaggccttcttcttcttcttcgtcttcacccagacttccaattcgactcgggtctttcaagtgcaaggctcaaagctcaagctctcagtctcagactgtttatcagggcgtctatggcccttggtctgttgactccaccgacgttaaagaggtgattctgtacaggtctggattggtgactgcagctacgtcatttgtaattgcagcttctactgcttttttgcccgacagtttcttggccactgagattgttaagcccaatcttgattacatatacgcaattggagccggtgggttgggtttgtcgttggttctgattcacatttatgtgactgagattaagcgcactttgcaagcgttttgggggcttggtgttgttgggtctttggctacatatgtatgcttggctcaaccagctggagagggcttggttcagtatgttgttgataacccagttgctgtttggtttgttggtcctttgtttgcagcgctcacaggactggttttcaaggaaggtctttgctatggaaagttggaagctggaattctcacattcattatacccattgttcttcttgggcacctgagtgggttgatggatgatggagtgaaactttctctactgggttcatggatggccctgtttgtaatatttgctggcaggaagttcacacaacccattaaggatgacatcggtgacaagtctgtcttcatattccagtctctgcccgaagacgagaagaaggccttggttaagaagcttgagcaacagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF2301

Protein Analysis

280

Amino Acids

30.0

Weight (kDa)

8.26

Isoelectric Point (pI)

36.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013259)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G28140
fragaria_vesca FvH4_4g22640 FvH4_4g22640
malus_domestica MD13G1130900.v1.1
prunus_persica Prupe.1G214800_v2.0.a1
pyrus_communis pycom13g11420 pycom16g11150
rosa_chinensis RchiOBHm_Chr4g0428871
rosa_laevigata RLG00000007118
rosa_multiflora Rmu_co8417267.1_g000001 Rmu_sc0008612.1_g000007
rosa_roxburghii Rroxscaffold_5G00370550
rosa_rugosa Rorug04G0229900
rosa_samantha Rh4AG286600 Rh4BG292400 Rh4CG308400 Rh4DG289600
rosa_wichuraiana Rw4G024850

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 773
AccB1I GGYRCC 1 cut(s) 648
AcoI YGGCCR 1 cut(s) 306
AcsI RAATTY 1 cut(s) 612
AcyI GRCGYC 1 cut(s) 177
AfaI GTAC 1 cut(s) 230
AfeI AGCGCT 1 cut(s) 558
AgsI TTSAA 2 cut(s) 127, 577
AjuI GAANNNNNNNTTGG 4 cut(s) 61, 93, 800, 832
AleI CACNNNNGTG 1 cut(s) 654
AluBI AGCT 8 cut(s) 64, 144, 150, 254, 275, 485, 608, 829
AluI AGCT 8 cut(s) 64, 144, 150, 254, 275, 485, 608, 829
Alw26I GTCTC 2 cut(s) 162, 795
AlwNI CAGNNNCTG 2 cut(s) 527, 793
Ama87I CYCGRG 1 cut(s) 116
Aor51HI AGCGCT 1 cut(s) 558
AoxI GGCC 5 cut(s) 71, 184, 306, 705, 813
ApeKI GCWGC 3 cut(s) 251, 272, 554
ApoI RAATTY 1 cut(s) 612
ArsI GACNNNNNNTTYG 2 cut(s) 93, 125
AspLEI GCGC 2 cut(s) 414, 559
AspS9I GGNCC 3 cut(s) 185, 542, 706
AsuHPI GGTGA 5 cut(s) 49, 87, 232, 256, 776
AvaI CYCGRG 1 cut(s) 116
AvaII GGWCC 1 cut(s) 542
BaeGI GKGCMC 1 cut(s) 651
BalI TGGCCA 1 cut(s) 308
BanI GGYRCC 1 cut(s) 648
BbsI GAAGAC 3 cut(s) 84, 769, 807
BbvI GCAGC 3 cut(s) 263, 284, 566
BccI CCATC 3 cut(s) 658, 665, 697
BcoDI GTCTC 2 cut(s) 162, 795
BfmI CTRYAG 1 cut(s) 249
BfoI RGCGCY 1 cut(s) 560
BisI GCNGC 3 cut(s) 252, 273, 555
BlsI GCNGC 3 cut(s) 253, 274, 556
Bme18I GGWCC 1 cut(s) 542
BmeT110I CYCGRG 1 cut(s) 116
BmgT120I GGNCC 3 cut(s) 185, 542, 706
BmiI GGNNCC 2 cut(s) 355, 650
BmrI ACTGGG 2 cut(s) 515, 701
BmsI GCATC 2 cut(s) 32, 56
BmuI ACTGGG 2 cut(s) 515, 701
BoxI GACNNNNGTC 1 cut(s) 118
BpiI GAAGAC 3 cut(s) 84, 769, 807
BpmI CTGGAG 1 cut(s) 507
BpuEI CTTGAG 1 cut(s) 130
BsaHI GRCGYC 1 cut(s) 177
BsaJI CCNNGG 3 cut(s) 68, 188, 816
BsaXI ACNNNNNCTCC 2 cut(s) 25, 55
Bse118I RCCGGY 1 cut(s) 356
Bse1I ACTGG 4 cut(s) 521, 573, 696, 787
BseDI CCNNGG 3 cut(s) 68, 188, 816
BseGI GGATG 4 cut(s) 23, 673, 708, 760
BseMII CTCAG 5 cut(s) 167, 173, 303, 393, 644
BseNI ACTGG 4 cut(s) 521, 573, 696, 787
BseSI GKGCMC 1 cut(s) 651
BseXI GCAGC 3 cut(s) 263, 284, 566
BshFI GGCC 5 cut(s) 73, 186, 308, 707, 815
BshNI GGYRCC 1 cut(s) 648
BsiHKCI CYCGRG 1 cut(s) 116
BsiSI CCGG 1 cut(s) 357
BsmAI GTCTC 2 cut(s) 162, 795
BsnI GGCC 5 cut(s) 73, 186, 308, 707, 815
BsoBI CYCGRG 1 cut(s) 116
Bsp1286I GDGCHC 1 cut(s) 651
Bsp1407I TGTACA 1 cut(s) 228
BspANI GGCC 5 cut(s) 73, 186, 308, 707, 815
BspCNI CTCAG 5 cut(s) 166, 172, 304, 394, 645
BspLI GGNNCC 2 cut(s) 355, 650
BspMAI CTGCAG 1 cut(s) 253
BspT107I GGYRCC 1 cut(s) 648
BsrFI RCCGGY 1 cut(s) 356
BsrGI TGTACA 1 cut(s) 228
BsrI ACTGG 4 cut(s) 521, 573, 696, 787
BssAI RCCGGY 1 cut(s) 356
BssECI CCNNGG 3 cut(s) 68, 188, 816
BssNI GRCGYC 1 cut(s) 177
BssT1I CCWWGG 3 cut(s) 68, 188, 816
Bst4CI ACNGT 3 cut(s) 166, 299, 840
BstACI GRCGYC 1 cut(s) 177
BstAUI TGTACA 1 cut(s) 228
BstC8I GCNNGC 2 cut(s) 423, 727
BstDEI CTNAG 5 cut(s) 153, 159, 312, 402, 653
BstF5I GGATG 4 cut(s) 23, 673, 708, 760
BstH2I RGCGCY 1 cut(s) 560
BstHHI GCGC 2 cut(s) 414, 559
BstMAI GTCTC 2 cut(s) 162, 795
BstMWI GCNNNNNNNGC 6 cut(s) 70, 183, 281, 353, 418, 482
BstPAI GACNNNNGTC 1 cut(s) 118
BstSFI CTRYAG 1 cut(s) 249
BstSLI GKGCMC 1 cut(s) 651
BstV1I GCAGC 3 cut(s) 263, 284, 566
BstV2I GAAGAC 3 cut(s) 84, 769, 807
BsuRI GGCC 5 cut(s) 73, 186, 308, 707, 815
BtsCI GGATG 4 cut(s) 23, 673, 708, 760
BtsIMutI CAGTG 1 cut(s) 309
Cac8I GCNNGC 2 cut(s) 423, 727
CaiI CAGNNNCTG 2 cut(s) 527, 793
CfoI GCGC 2 cut(s) 414, 559
Cfr10I RCCGGY 1 cut(s) 356
Cfr13I GGNCC 3 cut(s) 185, 542, 706
CseI GACGC 1 cut(s) 166
Csp6I GTAC 1 cut(s) 229
CspCI CAANNNNNGTGG 2 cut(s) 298, 333
CviAII CATG 1 cut(s) 699
CviQI GTAC 1 cut(s) 229
DdeI CTNAG 5 cut(s) 153, 159, 312, 402, 653
DrdI GACNNNNNNGTC 1 cut(s) 773
DseDI GACNNNNNNGTC 1 cut(s) 773
EaeI YGGCCR 1 cut(s) 306
Eco130I CCWWGG 3 cut(s) 68, 188, 816
Eco147I AGGCCT 2 cut(s) 73, 815
Eco47I GGWCC 1 cut(s) 542
Eco47III AGCGCT 1 cut(s) 558
Eco88I CYCGRG 1 cut(s) 116
EcoRI GAATTC 1 cut(s) 612
EcoT14I CCWWGG 3 cut(s) 68, 188, 816
ErhI CCWWGG 3 cut(s) 68, 188, 816
FaeI CATG 1 cut(s) 702
FalI AAGNNNNNCTT 6 cut(s) 61, 93, 761, 793, 800, 832
FatI CATG 1 cut(s) 698
FauNDI CATATG 2 cut(s) 12, 463
Fnu4HI GCNGC 3 cut(s) 252, 273, 555
FokI GGATG 4 cut(s) 10, 680, 715, 767
Fsp4HI GCNGC 3 cut(s) 252, 273, 555
GlaI GCGC 2 cut(s) 413, 558
GluI GCNGC 3 cut(s) 252, 273, 555
GsuI CTGGAG 1 cut(s) 507
HaeII RGCGCY 1 cut(s) 560
HaeIII GGCC 5 cut(s) 73, 186, 308, 707, 815
HapII CCGG 1 cut(s) 357
HgaI GACGC 1 cut(s) 166
HhaI GCGC 2 cut(s) 414, 559
Hin1I GRCGYC 1 cut(s) 177
Hin1II CATG 1 cut(s) 702
Hin6I GCGC 2 cut(s) 412, 557
HinP1I GCGC 2 cut(s) 412, 557
HincII GTYRAC 1 cut(s) 199
HindII GTYRAC 1 cut(s) 199
HindIII AAGCTT 2 cut(s) 62, 827
HinfI GANTC 4 cut(s) 114, 200, 223, 385
HpaII CCGG 1 cut(s) 357
HphI GGTGA 5 cut(s) 49, 87, 232, 256, 776
Hpy166II GTNNAC 2 cut(s) 199, 738
Hpy188I TCNGA 2 cut(s) 162, 384
Hpy188III TCNNGA 2 cut(s) 237, 332
Hpy8I GTNNAC 2 cut(s) 199, 738
Hpy99I CGWCG 1 cut(s) 212
HpyAV CCTTC 3 cut(s) 84, 575, 805
HpyCH4III ACNGT 3 cut(s) 166, 299, 840
HpyCH4IV ACGT 2 cut(s) 210, 257
HpyCH4V TGCA 7 cut(s) 23, 47, 132, 251, 272, 421, 554
HpyF10VI GCNNNNNNNGC 6 cut(s) 70, 183, 281, 353, 418, 482
HpyF3I CTNAG 5 cut(s) 153, 159, 312, 402, 653
HpySE526I ACGT 2 cut(s) 210, 257
Hsp92I GRCGYC 1 cut(s) 177
Hsp92II CATG 1 cut(s) 702
HspAI GCGC 2 cut(s) 412, 557
LmnI GCTCC 1 cut(s) 353
Lsp1109I GCAGC 3 cut(s) 263, 284, 566
LweI GCATC 2 cut(s) 32, 56
MaeII ACGT 2 cut(s) 210, 257
MaeIII GTNAC 4 cut(s) 31, 244, 397, 764
MboII GAAGA 9 cut(s) 69, 72, 75, 78, 84, 632, 769, 812, 820
MfeI CAATTG 1 cut(s) 348
MhlI GDGCHC 1 cut(s) 651
MlsI TGGCCA 1 cut(s) 308
MluCI AATT 4 cut(s) 108, 267, 348, 612
MluNI TGGCCA 1 cut(s) 308
MlyI GAGTC 2 cut(s) 108, 194
MmeI TCCRAC 1 cut(s) 582
MnlI CCTC 3 cut(s) 65, 211, 484
Mox20I TGGCCA 1 cut(s) 308
MscI TGGCCA 1 cut(s) 308
MseI TTAA 5 cut(s) 213, 321, 408, 750, 822
MslI CAYNNNNRTG 4 cut(s) 393, 395, 466, 654
Msp20I TGGCCA 1 cut(s) 308
MspA1I CMGCKG 1 cut(s) 485
MspI CCGG 1 cut(s) 357
MunI CAATTG 1 cut(s) 348
MwoI GCNNNNNNNGC 6 cut(s) 70, 183, 281, 353, 418, 482
NdeI CATATG 2 cut(s) 12, 463
NlaIII CATG 1 cut(s) 702
NlaIV GGNNCC 2 cut(s) 355, 650
NmuCI GTSAC 4 cut(s) 31, 244, 397, 764
OliI CACNNNNGTG 1 cut(s) 654
PceI AGGCCT 2 cut(s) 73, 815
PfeI GAWTC 2 cut(s) 223, 385
PkrI GCNGC 3 cut(s) 253, 274, 556
PleI GAGTC 2 cut(s) 108, 194
PpsI GAGTC 2 cut(s) 108, 194
PshAI GACNNNNGTC 1 cut(s) 118
PspN4I GGNNCC 2 cut(s) 355, 650
PspPI GGNCC 3 cut(s) 185, 542, 706
PstI CTGCAG 1 cut(s) 253
PstNI CAGNNNCTG 2 cut(s) 527, 793
PvuII CAGCTG 1 cut(s) 485
RsaI GTAC 1 cut(s) 230
RsaNI GTAC 1 cut(s) 229
RseI CAYNNNNRTG 4 cut(s) 393, 395, 466, 654
SaqAI TTAA 5 cut(s) 213, 321, 408, 750, 822
SatI GCNGC 3 cut(s) 252, 273, 555
Sau96I GGNCC 3 cut(s) 185, 542, 706
SchI GAGTC 2 cut(s) 108, 194
SduI GDGCHC 1 cut(s) 651
SfaNI GCATC 2 cut(s) 32, 56
SfcI CTRYAG 1 cut(s) 249
SinI GGWCC 1 cut(s) 542
SmiMI CAYNNNNRTG 4 cut(s) 393, 395, 466, 654
SmlI CTYRAG 2 cut(s) 145, 830
SmoI CTYRAG 2 cut(s) 145, 830
Sse9I AATT 4 cut(s) 108, 267, 348, 612
SseBI AGGCCT 2 cut(s) 73, 815
SspI AATATT 1 cut(s) 720
StuI AGGCCT 2 cut(s) 73, 815
StyI CCWWGG 3 cut(s) 68, 188, 816
TaaI ACNGT 3 cut(s) 166, 299, 840
TaiI ACGT 2 cut(s) 213, 260
TaqI TCGA 1 cut(s) 112
TasI AATT 4 cut(s) 108, 267, 348, 612
TatI WGTACW 1 cut(s) 228
TfiI GAWTC 2 cut(s) 223, 385
Tru1I TTAA 5 cut(s) 213, 321, 408, 750, 822
Tru9I TTAA 5 cut(s) 213, 321, 408, 750, 822
TscAI CASTG 1 cut(s) 316
TseFI GTSAC 4 cut(s) 31, 244, 397, 764
TseI GCWGC 3 cut(s) 251, 272, 554
Tsp45I GTSAC 4 cut(s) 31, 244, 397, 764
TspDTI ATGAA 3 cut(s) 613, 687, 769
TspRI CASTG 1 cut(s) 316
VpaK11BI GGWCC 1 cut(s) 542
XapI RAATTY 1 cut(s) 612
XcmI CCANNNNNNNNNTGG 1 cut(s) 528
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.