Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008789.1

Orthogroup ID

OG0007868

Physical Location & Seq

Genomic Coordinates Reverse (-)

35203 .. 35528

Gene Structure 326 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008789.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 249 bp

atgttgaaagctctgagaatctacgcggaggttctgagattggtgcggcggttacccaaggactctcggccttactacgccaagtacgttcgggagaatttcgtcaattacagagaggtcgaggtctccgatgaccaagctctccacgacctcttcaacagggcttacattcattccctctgggtcctcaacaagtactctgttgatgaatccgccgccgataagttgaagaagatctgcagcggttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Complex1_LYR

Protein Analysis

82

Amino Acids

9.75

Weight (kDa)

9.3

Isoelectric Point (pI)

34.89

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007868)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G19508
fragaria_vesca	FvH4_2g04840 FvH4_2g04840 FvH4_2g04840 FvH4_2g04840 FvH4_2g04840 FvH4_2g04840 FvH4_2g04840
malus_domestica	MD00G1109400.v1.1 MD04G1005100.v1.1 MD05G1023600.v1.1
prunus_persica	Prupe.8G136900_v2.0.a1
pyrus_communis	pycom05g09110
rosa_chinensis	RchiOBHm_Chr6g0254661 RchiOBHm_Chr6g0254711
rosa_multiflora	Rmu_sc0000053.1_g000002 Rmu_sc0008789.1_g000005
rosa_roxburghii	Rroxscaffold_7G00210110 Rroxscaffold_7G00210660
rosa_rugosa	Rorug05G0554200
rosa_samantha	Rh6AG071300 Rh6CG062700 Rh6DG059900
rosa_wichuraiana	Rw6G006240

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	26
AciI	CCGC	6 cut(s)	26, 46, 49, 213, 216, 243
AcsI	RAATTY	1 cut(s)	97
AfaI	GTAC	2 cut(s)	86, 197
AgsI	TTSAA	3 cut(s)	7, 157, 229
AluBI	AGCT	2 cut(s)	11, 140
AluI	AGCT	2 cut(s)	11, 140
Alw26I	GTCTC	1 cut(s)	130
AoxI	GGCC	1 cut(s)	68
ApeKI	GCWGC	1 cut(s)	240
ApoI	RAATTY	1 cut(s)	97
AspS9I	GGNCC	1 cut(s)	184
AvaII	GGWCC	1 cut(s)	184
BcoDI	GTCTC	1 cut(s)	130
BfmI	CTRYAG	1 cut(s)	238
BglII	AGATCT	1 cut(s)	234
BisI	GCNGC	3 cut(s)	47, 216, 241
BlsI	GCNGC	3 cut(s)	48, 217, 242
BmcAI	AGTACT	1 cut(s)	197
Bme18I	GGWCC	1 cut(s)	184
BmgT120I	GGNCC	1 cut(s)	184
BmiI	GGNNCC	1 cut(s)	185
BsaI	GGTCTC	1 cut(s)	130
BsaJI	CCNNGG	1 cut(s)	57
BseDI	CCNNGG	1 cut(s)	57
BseMII	CTCAG	2 cut(s)	5, 26
Bsh1236I	CGCG	1 cut(s)	26
BshFI	GGCC	1 cut(s)	70
BsmAI	GTCTC	1 cut(s)	130
BsnI	GGCC	1 cut(s)	70
Bso31I	GGTCTC	1 cut(s)	130
Bsp143I	GATC	1 cut(s)	234
BspACI	CCGC	6 cut(s)	26, 46, 49, 213, 216, 243
BspANI	GGCC	1 cut(s)	70
BspCNI	CTCAG	2 cut(s)	6, 27
BspFNI	CGCG	1 cut(s)	26
BspLI	GGNNCC	1 cut(s)	185
BspMAI	CTGCAG	1 cut(s)	242
BspTNI	GGTCTC	1 cut(s)	130
BssECI	CCNNGG	1 cut(s)	57
BssMI	GATC	1 cut(s)	234
BssT1I	CCWWGG	1 cut(s)	57
Bst6I	CTCTTC	1 cut(s)	158
BstDEI	CTNAG	2 cut(s)	14, 35
BstEII	GGTNACC	1 cut(s)	51
BstFNI	CGCG	1 cut(s)	26
BstKTI	GATC	1 cut(s)	237
BstMAI	GTCTC	1 cut(s)	130
BstMBI	GATC	1 cut(s)	234
BstPI	GGTNACC	1 cut(s)	51
BstSFI	CTRYAG	1 cut(s)	238
BstUI	CGCG	1 cut(s)	26
BstX2I	RGATCY	1 cut(s)	234
BstYI	RGATCY	1 cut(s)	234
BsuRI	GGCC	1 cut(s)	70
Cfr13I	GGNCC	1 cut(s)	184
Csp6I	GTAC	2 cut(s)	85, 196
CviJI	RGCY	4 cut(s)	11, 70, 140, 164
CviKI_1	RGCY	4 cut(s)	11, 70, 140, 164
CviQI	GTAC	2 cut(s)	85, 196
DdeI	CTNAG	2 cut(s)	14, 35
DpnI	GATC	1 cut(s)	236
DpnII	GATC	1 cut(s)	234
Eam1104I	CTCTTC	1 cut(s)	158
EarI	CTCTTC	1 cut(s)	158
EciI	GGCGGA	1 cut(s)	202
Eco130I	CCWWGG	1 cut(s)	57
Eco31I	GGTCTC	1 cut(s)	130
Eco47I	GGWCC	1 cut(s)	184
Eco91I	GGTNACC	1 cut(s)	51
EcoO109I	RGGNCCY	1 cut(s)	184
EcoO65I	GGTNACC	1 cut(s)	51
EcoT14I	CCWWGG	1 cut(s)	57
ErhI	CCWWGG	1 cut(s)	57
Fnu4HI	GCNGC	3 cut(s)	47, 216, 241
Fsp4HI	GCNGC	3 cut(s)	47, 216, 241
GluI	GCNGC	3 cut(s)	47, 216, 241
HaeIII	GGCC	1 cut(s)	70
HinfI	GANTC	3 cut(s)	18, 62, 209
Hpy188I	TCNGA	3 cut(s)	15, 36, 130
Hpy188III	TCNNGA	1 cut(s)	92
HpyCH4IV	ACGT	1 cut(s)	87
HpyCH4V	TGCA	1 cut(s)	240
HpyF3I	CTNAG	2 cut(s)	14, 35
HpySE526I	ACGT	1 cut(s)	87
Kzo9I	GATC	1 cut(s)	234
LpnPI	CCDG	2 cut(s)	145, 166
MaeII	ACGT	1 cut(s)	87
MaeIII	GTNAC	1 cut(s)	51
MalI	GATC	1 cut(s)	236
MboI	GATC	1 cut(s)	234
MboII	GAAGA	3 cut(s)	145, 241, 244
MflI	RGATCY	1 cut(s)	234
MluCI	AATT	2 cut(s)	97, 106
MlyI	GAGTC	1 cut(s)	56
MnlI	CCTC	6 cut(s)	22, 109, 115, 161, 188, 197
MspA1I	CMGCKG	1 cut(s)	243
MvnI	CGCG	1 cut(s)	26
NdeII	GATC	1 cut(s)	234
NlaIV	GGNNCC	1 cut(s)	185
NmeAIII	GCCGAG	1 cut(s)	46
PcsI	WCGNNNNNNNCGW	2 cut(s)	84, 126
PfeI	GAWTC	2 cut(s)	18, 209
PkrI	GCNGC	3 cut(s)	48, 217, 242
PleI	GAGTC	1 cut(s)	56
PpsI	GAGTC	1 cut(s)	56
PpuMI	RGGWCCY	1 cut(s)	184
Psp5II	RGGWCCY	1 cut(s)	184
PspEI	GGTNACC	1 cut(s)	51
PspN4I	GGNNCC	1 cut(s)	185
PspPI	GGNCC	1 cut(s)	184
PspPPI	RGGWCCY	1 cut(s)	184
PstI	CTGCAG	1 cut(s)	242
PsuI	RGATCY	1 cut(s)	234
RsaI	GTAC	2 cut(s)	86, 197
RsaNI	GTAC	2 cut(s)	85, 196
SatI	GCNGC	3 cut(s)	47, 216, 241
Sau3AI	GATC	1 cut(s)	234
Sau96I	GGNCC	1 cut(s)	184
ScaI	AGTACT	1 cut(s)	197
SchI	GAGTC	1 cut(s)	56
SetI	ASST	7 cut(s)	13, 33, 90, 120, 126, 142, 153
SfcI	CTRYAG	1 cut(s)	238
SinI	GGWCC	1 cut(s)	184
Sse9I	AATT	2 cut(s)	97, 106
SsiI	CCGC	6 cut(s)	26, 46, 49, 213, 216, 243
StyI	CCWWGG	1 cut(s)	57
TaiI	ACGT	1 cut(s)	90
TaqI	TCGA	1 cut(s)	120
TasI	AATT	2 cut(s)	97, 106
TatI	WGTACW	1 cut(s)	195
TauI	GCSGC	2 cut(s)	49, 218
TfiI	GAWTC	2 cut(s)	18, 209
TseI	GCWGC	1 cut(s)	240
TspDTI	ATGAA	2 cut(s)	161, 222
VpaK11BI	GGWCC	1 cut(s)	184
XapI	RAATTY	1 cut(s)	97
ZrmI	AGTACT	1 cut(s)	197

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.